Rmu_sc0004431.1_g000012

Mitogen-activated protein kinase kinase kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004431.1
Physical Location & Seq
Reverse (-)
61297 .. 61572
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004431.1_g000012.1.cds

Sequence Viewer

Length: 276 bp
atggatgccaaagactggtggggcaaagcagtcatcctccatcagaacaaggactgtgtcgaattttacatacataatttgttctgctacttctcggctgtcattgaggcaatcgagaacgctggagagattgcggggctggaccaggatgagatgcagaagaagaggattgtgcttaagaggaagtatgataaggattggaatgacccgaaacttttccagtggagatttgtttgtatcagcttttgctatttttcaatgttagctaggatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.96

Weight (kDa)

6.7

Isoelectric Point (pI)

38.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019322)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 15
AciI CCGC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 62
AfiI CCNNNNNNNGG 1 cut(s) 15
AflII CTTAAG 1 cut(s) 176
AgsI TTSAA 1 cut(s) 258
AjnI CCWGG 1 cut(s) 144
AluBI AGCT 2 cut(s) 243, 266
AluI AGCT 2 cut(s) 243, 266
ApoI RAATTY 1 cut(s) 62
Asp700I GAANNNNTTC 1 cut(s) 215
AspS9I GGNCC 1 cut(s) 142
AvaII GGWCC 1 cut(s) 142
BccI CCATC 1 cut(s) 48
BciT130I CCWGG 1 cut(s) 146
BfaI CTAG 1 cut(s) 267
BfrI CTTAAG 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 146
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 146
BmsI GCATC 1 cut(s) 144
BpmI CTGGAG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 15
Bse1I ACTGG 2 cut(s) 20, 220
BseBI CCWGG 1 cut(s) 146
BseGI GGATG 4 cut(s) 10, 33, 154, 276
BseLI CCNNNNNNNGG 1 cut(s) 15
BseNI ACTGG 2 cut(s) 20, 220
BslI CCNNNNNNNGG 1 cut(s) 15
BspACI CCGC 1 cut(s) 134
BspTI CTTAAG 1 cut(s) 176
BsrI ACTGG 2 cut(s) 20, 220
Bst2UI CCWGG 1 cut(s) 146
Bst4CI ACNGT 1 cut(s) 56
Bst6I CTCTTC 1 cut(s) 158
BstAFI CTTAAG 1 cut(s) 176
BstF5I GGATG 4 cut(s) 10, 33, 154, 276
BstNI CCWGG 1 cut(s) 146
BstSCI CCNGG 1 cut(s) 144
BtsCI GGATG 4 cut(s) 10, 33, 154, 276
BtsIMutI CAGTG 1 cut(s) 227
Cfr13I GGNCC 1 cut(s) 142
CviJI RGCY 4 cut(s) 98, 139, 243, 266
CviKI_1 RGCY 4 cut(s) 98, 139, 243, 266
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
Eco47I GGWCC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 144
FaiI YATR 3 cut(s) 71, 75, 189
FauI CCCGC 1 cut(s) 127
FokI GGATG 3 cut(s) 17, 20, 161
FspBI CTAG 1 cut(s) 267
GsuI CTGGAG 1 cut(s) 144
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 56
HpyCH4V TGCA 1 cut(s) 157
LpnPI CCDG 5 cut(s) 108, 125, 131, 158, 233
LweI GCATC 1 cut(s) 144
MaeI CTAG 1 cut(s) 267
MboII GAAGA 2 cut(s) 172, 175
MluCI AATT 2 cut(s) 62, 76
MnlI CCTC 4 cut(s) 47, 100, 159, 174
MroXI GAANNNNTTC 1 cut(s) 215
MseI TTAA 1 cut(s) 177
MspCI CTTAAG 1 cut(s) 176
MspR9I CCNGG 1 cut(s) 146
MvaI CCWGG 1 cut(s) 146
NmeAIII GCCGAG 1 cut(s) 74
PdmI GAANNNNTTC 1 cut(s) 215
PflFI GACNNNGTC 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 144
PspGI CCWGG 1 cut(s) 144
PspPI GGNCC 1 cut(s) 142
PsyI GACNNNGTC 1 cut(s) 56
SaqAI TTAA 1 cut(s) 177
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 146
SetI ASST 2 cut(s) 245, 268
SfaNI GCATC 1 cut(s) 144
SinI GGWCC 1 cut(s) 142
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
Sse9I AATT 2 cut(s) 62, 76
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 267
StyD4I CCNGG 1 cut(s) 144
TaaI ACNGT 1 cut(s) 56
TaqI TCGA 2 cut(s) 60, 114
TasI AATT 2 cut(s) 62, 76
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TscAI CASTG 1 cut(s) 227
TspRI CASTG 1 cut(s) 227
Tth111I GACNNNGTC 1 cut(s) 56
Van91I CCANNNNNTGG 1 cut(s) 15
Vha464I CTTAAG 1 cut(s) 176
VpaK11BI GGWCC 1 cut(s) 142
XapI RAATTY 1 cut(s) 62
XmnI GAANNNNTTC 1 cut(s) 215
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.