Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000410.1

Orthogroup ID

OG0019322

Physical Location & Seq

Genomic Coordinates Forward (+)

263987 .. 264358

Gene Structure 372 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000410.1_g000042.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 372 bp

atggtatcaagatcaatcaagggcagtgctgtctatgaacctctgagggagctctacacagttttcagagaaagcgagatttacatcagaagctgcatggatgccaaagactggtggggcaaagcagttatcctccatcagaacaaggactgtgtcaaattttacatacataatttgttctgctacttctcggctgtcattgaggcaattgagaacgctggagagattgcggggctggaccaggatgagatgcagaagaagaggattgtgcttaagaggaagtatgataaggattggaatgacccgaaacttttccagtggagatttgtttgtatcagcttttgctatttttcaatgttagctaggatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1221 Pkinase_Tyr

Protein Analysis

123

Amino Acids

14.73

Weight (kDa)

8.58

Isoelectric Point (pI)

49.67

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019322)

Species	Orthologous Gene IDs
pyrus_communis	pycom07g14460
rosa_multiflora	Rmu_sc0000388.1_g000046 Rmu_sc0004431.1_g000012 Rmu_ssc0000410.1_g000042
rosa_samantha	Rh4CG094400 Rh5BG488600 Rh5DG305600 Rh7CG229500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	111
AciI	CCGC	1 cut(s)	230
AcsI	RAATTY	1 cut(s)	158
AfiI	CCNNNNNNNGG	1 cut(s)	111
AflII	CTTAAG	1 cut(s)	272
AgsI	TTSAA	1 cut(s)	354
AjnI	CCWGG	1 cut(s)	240
AluBI	AGCT	4 cut(s)	52, 93, 339, 362
AluI	AGCT	4 cut(s)	52, 93, 339, 362
Alw21I	GWGCWC	1 cut(s)	54
AlwNI	CAGNNNCTG	1 cut(s)	93
ApeKI	GCWGC	1 cut(s)	93
ApoI	RAATTY	1 cut(s)	158
Asp700I	GAANNNNTTC	1 cut(s)	311
AspS9I	GGNCC	1 cut(s)	238
AvaII	GGWCC	1 cut(s)	238
BanII	GRGCYC	1 cut(s)	54
Bbv12I	GWGCWC	1 cut(s)	54
BbvI	GCAGC	1 cut(s)	80
BccI	CCATC	1 cut(s)	144
BciT130I	CCWGG	1 cut(s)	242
BfaI	CTAG	1 cut(s)	363
BfrI	CTTAAG	1 cut(s)	272
BisI	GCNGC	1 cut(s)	94
BlsI	GCNGC	1 cut(s)	95
Bme1390I	CCNGG	1 cut(s)	242
Bme18I	GGWCC	1 cut(s)	238
BmgT120I	GGNCC	1 cut(s)	238
BmrFI	CCNGG	1 cut(s)	242
BmsI	GCATC	2 cut(s)	91, 240
BpmI	CTGGAG	1 cut(s)	240
BsaBI	GATNNNNATC	1 cut(s)	83
Bsc4I	CCNNNNNNNGG	1 cut(s)	111
Bse1I	ACTGG	2 cut(s)	116, 316
Bse8I	GATNNNNATC	1 cut(s)	83
BseBI	CCWGG	1 cut(s)	242
BseGI	GGATG	3 cut(s)	106, 250, 372
BseJI	GATNNNNATC	1 cut(s)	83
BseLI	CCNNNNNNNGG	1 cut(s)	111
BseMII	CTCAG	1 cut(s)	35
BseNI	ACTGG	2 cut(s)	116, 316
BseXI	GCAGC	1 cut(s)	80
BsiHKAI	GWGCWC	1 cut(s)	54
BslI	CCNNNNNNNGG	1 cut(s)	111
Bsp1286I	GDGCHC	1 cut(s)	54
Bsp143I	GATC	1 cut(s)	11
BspACI	CCGC	1 cut(s)	230
BspCNI	CTCAG	1 cut(s)	36
BspTI	CTTAAG	1 cut(s)	272
BsrI	ACTGG	2 cut(s)	116, 316
BssMI	GATC	1 cut(s)	11
Bst2UI	CCWGG	1 cut(s)	242
Bst4CI	ACNGT	2 cut(s)	61, 152
Bst6I	CTCTTC	1 cut(s)	254
BstAFI	CTTAAG	1 cut(s)	272
BstDEI	CTNAG	1 cut(s)	44
BstF5I	GGATG	3 cut(s)	106, 250, 372
BstKTI	GATC	1 cut(s)	14
BstMBI	GATC	1 cut(s)	11
BstNI	CCWGG	1 cut(s)	242
BstSCI	CCNGG	1 cut(s)	240
BstV1I	GCAGC	1 cut(s)	80
BtsCI	GGATG	3 cut(s)	106, 250, 372
BtsI	GCAGTG	1 cut(s)	31
BtsIMutI	CAGTG	2 cut(s)	31, 323
CaiI	CAGNNNCTG	1 cut(s)	93
Cfr13I	GGNCC	1 cut(s)	238
CviAII	CATG	1 cut(s)	97
CviJI	RGCY	6 cut(s)	52, 93, 194, 235, 339, 362
CviKI_1	RGCY	6 cut(s)	52, 93, 194, 235, 339, 362
DdeI	CTNAG	1 cut(s)	44
DpnI	GATC	1 cut(s)	13
DpnII	GATC	1 cut(s)	11
Eam1104I	CTCTTC	1 cut(s)	254
EarI	CTCTTC	1 cut(s)	254
Ecl136II	GAGCTC	1 cut(s)	52
Eco24I	GRGCYC	1 cut(s)	54
Eco47I	GGWCC	1 cut(s)	238
Eco53kI	GAGCTC	1 cut(s)	52
EcoICRI	GAGCTC	1 cut(s)	52
EcoRII	CCWGG	1 cut(s)	240
EcoT38I	GRGCYC	1 cut(s)	54
FaeI	CATG	1 cut(s)	100
FaiI	YATR	5 cut(s)	36, 98, 167, 171, 285
FatI	CATG	1 cut(s)	96
FauI	CCCGC	1 cut(s)	223
Fnu4HI	GCNGC	1 cut(s)	94
FokI	GGATG	2 cut(s)	113, 257
FriOI	GRGCYC	1 cut(s)	54
Fsp4HI	GCNGC	1 cut(s)	94
FspBI	CTAG	1 cut(s)	363
GluI	GCNGC	1 cut(s)	94
GsuI	CTGGAG	1 cut(s)	240
Hin1II	CATG	1 cut(s)	100
Hpy188I	TCNGA	4 cut(s)	45, 68, 89, 141
Hpy188III	TCNNGA	1 cut(s)	9
HpyCH4III	ACNGT	2 cut(s)	61, 152
HpyCH4V	TGCA	2 cut(s)	96, 253
HpyF3I	CTNAG	1 cut(s)	44
Hsp92II	CATG	1 cut(s)	100
Kzo9I	GATC	1 cut(s)	11
LmnI	GCTCC	1 cut(s)	49
LpnPI	CCDG	6 cut(s)	97, 204, 221, 227, 254, 329
Lsp1109I	GCAGC	1 cut(s)	80
LweI	GCATC	2 cut(s)	91, 240
MaeI	CTAG	1 cut(s)	363
MalI	GATC	1 cut(s)	13
MboI	GATC	1 cut(s)	11
MboII	GAAGA	2 cut(s)	268, 271
MfeI	CAATTG	1 cut(s)	207
MhlI	GDGCHC	1 cut(s)	54
MluCI	AATT	3 cut(s)	158, 172, 207
MnlI	CCTC	6 cut(s)	39, 51, 143, 196, 255, 270
MroXI	GAANNNNTTC	1 cut(s)	311
MseI	TTAA	1 cut(s)	273
MspCI	CTTAAG	1 cut(s)	272
MspR9I	CCNGG	1 cut(s)	242
MunI	CAATTG	1 cut(s)	207
MvaI	CCWGG	1 cut(s)	242
NdeII	GATC	1 cut(s)	11
NlaIII	CATG	1 cut(s)	100
NmeAIII	GCCGAG	1 cut(s)	170
PdmI	GAANNNNTTC	1 cut(s)	311
PflFI	GACNNNGTC	1 cut(s)	152
PflMI	CCANNNNNTGG	1 cut(s)	111
PkrI	GCNGC	1 cut(s)	95
Psp124BI	GAGCTC	1 cut(s)	54
Psp6I	CCWGG	1 cut(s)	240
PspGI	CCWGG	1 cut(s)	240
PspPI	GGNCC	1 cut(s)	238
PstNI	CAGNNNCTG	1 cut(s)	93
PsyI	GACNNNGTC	1 cut(s)	152
SacI	GAGCTC	1 cut(s)	54
SaqAI	TTAA	1 cut(s)	273
SatI	GCNGC	1 cut(s)	94
Sau3AI	GATC	1 cut(s)	11
Sau96I	GGNCC	1 cut(s)	238
ScrFI	CCNGG	1 cut(s)	242
SduI	GDGCHC	1 cut(s)	54
SetI	ASST	5 cut(s)	43, 54, 95, 341, 364
SfaNI	GCATC	2 cut(s)	91, 240
SinI	GGWCC	1 cut(s)	238
SmlI	CTYRAG	1 cut(s)	272
SmoI	CTYRAG	1 cut(s)	272
Sse9I	AATT	3 cut(s)	158, 172, 207
SsiI	CCGC	1 cut(s)	230
SspMI	CTAG	1 cut(s)	363
SstI	GAGCTC	1 cut(s)	54
StyD4I	CCNGG	1 cut(s)	240
TaaI	ACNGT	2 cut(s)	61, 152
TasI	AATT	3 cut(s)	158, 172, 207
Tru1I	TTAA	1 cut(s)	273
Tru9I	TTAA	1 cut(s)	273
TscAI	CASTG	2 cut(s)	31, 323
TseI	GCWGC	1 cut(s)	93
TspDTI	ATGAA	1 cut(s)	51
TspRI	CASTG	2 cut(s)	31, 323
Tth111I	GACNNNGTC	1 cut(s)	152
Van91I	CCANNNNNTGG	1 cut(s)	111
Vha464I	CTTAAG	1 cut(s)	272
VpaK11BI	GGWCC	1 cut(s)	238
XapI	RAATTY	1 cut(s)	158
XmnI	GAANNNNTTC	1 cut(s)	311
XspI	CTAG	1 cut(s)	363

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.