Rmu_sc0005314.1_g000007

Bet1-like SNARE

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005314.1
Physical Location & Seq
Reverse (-)
40525 .. 43081
2557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005314.1_g000007.1.cds

Sequence Viewer

Length: 369 bp
atgaatgctcgaagggactaccgcaacaacaaggtcgctctttttgatggcattgaggagggtggcatcagggcctcatcttcctattcccatgaaatcgatgagcaagataatgaaagggcagtggaaggattgcaagatagagtcaatttgctgaagagattgtcaggtgacatacatgaggaggtagagagtcataatcacatgctggaccgaatgggaaacgatatggattcatcaaggggaatgctatccggtacaatggacaggtttaagacggtttttgagaccaagtcaagccagagaatgtttacactggtggcatcatttctggtcgtctttctagttatatactatctcactaggtaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

122

Amino Acids

14.1

Weight (kDa)

5.53

Isoelectric Point (pI)

47.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012897)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 22
AcuI CTGAAG 1 cut(s) 176
AfaI GTAC 1 cut(s) 259
Alw26I GTCTC 1 cut(s) 281
AoxI GGCC 1 cut(s) 72
AspS9I GGNCC 2 cut(s) 72, 211
AsuHPI GGTGA 1 cut(s) 182
AvaII GGWCC 1 cut(s) 211
BccI CCATC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 281
BfaI CTAG 2 cut(s) 344, 363
Bme18I GGWCC 1 cut(s) 211
BmgT120I GGNCC 2 cut(s) 72, 211
BmsI GCATC 2 cut(s) 75, 332
Bsa29I ATCGAT 1 cut(s) 99
BsaI GGTCTC 1 cut(s) 281
BsaWI WCCGGW 1 cut(s) 254
Bse1I ACTGG 1 cut(s) 321
BseCI ATCGAT 1 cut(s) 99
BseNI ACTGG 1 cut(s) 321
BseRI GAGGAG 2 cut(s) 71, 197
BshFI GGCC 1 cut(s) 74
BshVI ATCGAT 1 cut(s) 99
BsiSI CCGG 1 cut(s) 255
BslFI GGGAC 1 cut(s) 29
BsmAI GTCTC 1 cut(s) 281
BsmFI GGGAC 1 cut(s) 29
BsmI GAATGC 2 cut(s) 10, 252
BsnI GGCC 1 cut(s) 74
Bso31I GGTCTC 1 cut(s) 281
BspACI CCGC 1 cut(s) 22
BspANI GGCC 1 cut(s) 74
BspDI ATCGAT 1 cut(s) 99
BspTNI GGTCTC 1 cut(s) 281
BsrI ACTGG 1 cut(s) 321
Bst4CI ACNGT 1 cut(s) 280
Bst6I CTCTTC 1 cut(s) 152
BstMAI GTCTC 1 cut(s) 281
BstNSI RCATGY 1 cut(s) 208
Bsu15I ATCGAT 1 cut(s) 99
BsuRI GGCC 1 cut(s) 74
BsuTUI ATCGAT 1 cut(s) 99
BtsI GCAGTG 1 cut(s) 129
BtsIMutI CAGTG 2 cut(s) 129, 314
Cfr13I GGNCC 2 cut(s) 72, 211
ClaI ATCGAT 1 cut(s) 99
Csp6I GTAC 1 cut(s) 258
CviAII CATG 3 cut(s) 92, 179, 205
CviJI RGCY 2 cut(s) 74, 300
CviKI_1 RGCY 2 cut(s) 74, 300
CviQI GTAC 1 cut(s) 258
Eam1104I CTCTTC 1 cut(s) 152
EarI CTCTTC 1 cut(s) 152
Eco31I GGTCTC 1 cut(s) 281
Eco47I GGWCC 1 cut(s) 211
Eco57I CTGAAG 1 cut(s) 176
EcoO109I RGGNCCY 1 cut(s) 72
FaeI CATG 3 cut(s) 95, 182, 208
FaiI YATR 8 cut(s) 93, 176, 180, 198, 206, 230, 350, 352
FaqI GGGAC 1 cut(s) 29
FatI CATG 3 cut(s) 91, 178, 204
FspBI CTAG 2 cut(s) 344, 363
HaeIII GGCC 1 cut(s) 74
HapII CCGG 1 cut(s) 255
Hin1II CATG 3 cut(s) 95, 182, 208
HinfI GANTC 3 cut(s) 144, 193, 233
HpaII CCGG 1 cut(s) 255
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 312
Hpy8I GTNNAC 1 cut(s) 312
HpyAV CCTTC 2 cut(s) 6, 122
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4V TGCA 1 cut(s) 136
Hsp92II CATG 3 cut(s) 95, 182, 208
LpnPI CCDG 8 cut(s) 55, 153, 194, 253, 268, 302, 314, 317
LweI GCATC 2 cut(s) 75, 332
MaeI CTAG 2 cut(s) 344, 363
MaeIII GTNAC 1 cut(s) 170
MboII GAAGA 2 cut(s) 72, 169
MluCI AATT 1 cut(s) 148
MlyI GAGTC 2 cut(s) 153, 202
MnlI CCTC 5 cut(s) 49, 52, 85, 175, 178
MseI TTAA 1 cut(s) 273
MspI CCGG 1 cut(s) 255
Mva1269I GAATGC 2 cut(s) 10, 252
NlaIII CATG 3 cut(s) 95, 182, 208
NmuCI GTSAC 1 cut(s) 170
NspI RCATGY 1 cut(s) 208
PctI GAATGC 2 cut(s) 10, 252
PfeI GAWTC 1 cut(s) 233
PflFI GACNNNGTC 1 cut(s) 292
PleI GAGTC 2 cut(s) 152, 201
PpsI GAGTC 2 cut(s) 152, 201
PspPI GGNCC 2 cut(s) 72, 211
PsyI GACNNNGTC 1 cut(s) 292
RsaI GTAC 1 cut(s) 259
RsaNI GTAC 1 cut(s) 258
SaqAI TTAA 1 cut(s) 273
Sau96I GGNCC 2 cut(s) 72, 211
SchI GAGTC 2 cut(s) 153, 202
SetI ASST 5 cut(s) 36, 172, 189, 272, 368
SfaNI GCATC 2 cut(s) 75, 332
SinI GGWCC 1 cut(s) 211
Sse9I AATT 1 cut(s) 148
SsiI CCGC 1 cut(s) 22
SspMI CTAG 2 cut(s) 344, 363
TaaI ACNGT 1 cut(s) 280
TaqI TCGA 2 cut(s) 10, 99
TaqII GACCGA 1 cut(s) 228
TasI AATT 1 cut(s) 148
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 1 cut(s) 273
Tru9I TTAA 1 cut(s) 273
TscAI CASTG 2 cut(s) 129, 321
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 4 cut(s) 17, 108, 129, 225
TspRI CASTG 2 cut(s) 129, 321
Tth111I GACNNNGTC 1 cut(s) 292
VpaK11BI GGWCC 1 cut(s) 211
XceI RCATGY 1 cut(s) 208
XspI CTAG 2 cut(s) 344, 363
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.