Rmu_sc0005362.1_g000027

Root cap

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005362.1
OG0006038
Physical Location & Seq
Forward (+)
98793 .. 99446
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005362.1_g000027.1.cds

Sequence Viewer

Length: 654 bp
atgctcgcttcattggtctccgccctgaaggccgaagcagggactatacctggattccaagcccttggactcctcttcgattcgaacagcttcacactcgaggccaccccatcagcaacatgggacgatgagattgaccacttgaagttctcttacaatggtgaggagctaatcatcccagaatcccatctctctgtttgggaatctcaggaaacttctattagagtggagaggacttcgagcaagaacagtgtcttagtcactctcccagaagtagctgaaatttcagtcaatgtggtacctgtgacaaaggaagatgataagatccacaattatcagataccatcagatgactgttttgctcacctggaagcacagttcagattctacggtctgtcatcaaatgttgaaggagtacttggaaggacttaccagccagatttcaagaacccggcaaaggctggagtagccatgccggtagttggaggtgaatacaagtacaaaacaacatcactggtctctgcggattgttttgcttgtgtgttcacccaggccgggatgttggatcagacggattcaagagtgatggattacggaaagctagactgcaccggtaacaccttcagtgggaatggaatagtttgcaggaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Root_cap

Protein Analysis

217

Amino Acids

23.71

Weight (kDa)

4.69

Isoelectric Point (pI)

27.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 298
AccB1I GGYRCC 1 cut(s) 298
AciI CCGC 2 cut(s) 21, 524
AclWI GGATC 2 cut(s) 319, 573
AcsI RAATTY 1 cut(s) 282
AcuI CTGAAG 2 cut(s) 47, 607
AfaI GTAC 3 cut(s) 300, 417, 500
AfiI CCNNNNNNNGG 5 cut(s) 39, 457, 482, 555, 627
AgeI ACCGGT 1 cut(s) 611
AgsI TTSAA 4 cut(s) 145, 410, 445, 579
AjnI CCWGG 3 cut(s) 49, 366, 549
AjuI GAANNNNNNNTTGG 2 cut(s) 402, 434
AloI GAACNNNNNNTCC 2 cut(s) 362, 394
AluBI AGCT 4 cut(s) 90, 169, 278, 601
AluI AGCT 4 cut(s) 90, 169, 278, 601
Alw26I GTCTC 2 cut(s) 22, 523
AlwI GGATC 2 cut(s) 319, 573
Ama87I CYCGRG 1 cut(s) 98
AoxI GGCC 3 cut(s) 30, 102, 552
ApoI RAATTY 1 cut(s) 282
AsiGI ACCGGT 1 cut(s) 611
Asp700I GAANNNNTTC 1 cut(s) 89
Asp718I GGTACC 1 cut(s) 298
AsuC2I CCSGG 2 cut(s) 452, 556
AsuHPI GGTGA 4 cut(s) 173, 356, 500, 538
AsuII TTCGAA 1 cut(s) 83
AvaI CYCGRG 1 cut(s) 98
BanI GGYRCC 1 cut(s) 298
BarI GAAGNNNNNNTAC 2 cut(s) 137, 169
BccI CCATC 4 cut(s) 118, 195, 352, 580
BciT130I CCWGG 3 cut(s) 51, 368, 551
BcnI CCSGG 2 cut(s) 452, 556
BcoDI GTCTC 2 cut(s) 22, 523
BfaI CTAG 1 cut(s) 602
BglI GCCNNNNNGGC 1 cut(s) 29
BmcAI AGTACT 1 cut(s) 417
Bme1390I CCNGG 5 cut(s) 51, 368, 452, 551, 556
BmeT110I CYCGRG 1 cut(s) 98
BmiI GGNNCC 1 cut(s) 300
BmrFI CCNGG 5 cut(s) 51, 368, 452, 551, 556
BpmI CTGGAG 1 cut(s) 483
Bpu14I TTCGAA 1 cut(s) 83
BpuMI CCSGG 2 cut(s) 452, 556
BsaI GGTCTC 2 cut(s) 22, 523
BsaJI CCNNGG 2 cut(s) 64, 549
BsaWI WCCGGW 1 cut(s) 611
Bsc4I CCNNNNNNNGG 5 cut(s) 39, 457, 482, 555, 627
Bse118I RCCGGY 2 cut(s) 475, 611
Bse1I ACTGG 1 cut(s) 519
BseBI CCWGG 3 cut(s) 51, 368, 551
BseDI CCNNGG 2 cut(s) 64, 549
BseGI GGATG 2 cut(s) 174, 564
BseLI CCNNNNNNNGG 5 cut(s) 39, 457, 482, 555, 627
BseMII CTCAG 1 cut(s) 221
BseNI ACTGG 1 cut(s) 519
BseRI GAGGAG 2 cut(s) 62, 179
BsgI GTGCAG 1 cut(s) 592
BshFI GGCC 3 cut(s) 32, 104, 554
BshNI GGYRCC 1 cut(s) 298
BshTI ACCGGT 1 cut(s) 611
BsiHKCI CYCGRG 1 cut(s) 98
BsiSI CCGG 4 cut(s) 452, 476, 555, 612
BslFI GGGAC 2 cut(s) 55, 137
BslI CCNNNNNNNGG 5 cut(s) 39, 457, 482, 555, 627
BsmAI GTCTC 2 cut(s) 22, 523
BsmFI GGGAC 2 cut(s) 55, 137
BsnI GGCC 3 cut(s) 32, 104, 554
Bso31I GGTCTC 2 cut(s) 22, 523
BsoBI CYCGRG 1 cut(s) 98
Bsp119I TTCGAA 1 cut(s) 83
Bsp143I GATC 2 cut(s) 324, 565
BspACI CCGC 2 cut(s) 21, 524
BspANI GGCC 3 cut(s) 32, 104, 554
BspCNI CTCAG 1 cut(s) 220
BspLI GGNNCC 1 cut(s) 300
BspPI GGATC 2 cut(s) 319, 573
BspT104I TTCGAA 1 cut(s) 83
BspT107I GGYRCC 1 cut(s) 298
BspTNI GGTCTC 2 cut(s) 22, 523
BsrFI RCCGGY 2 cut(s) 475, 611
BsrI ACTGG 1 cut(s) 519
BssAI RCCGGY 2 cut(s) 475, 611
BssECI CCNNGG 2 cut(s) 64, 549
BssMI GATC 2 cut(s) 324, 565
BssT1I CCWWGG 1 cut(s) 64
Bst2UI CCWGG 3 cut(s) 51, 368, 551
Bst4CI ACNGT 4 cut(s) 251, 356, 378, 392
Bst6I CTCTTC 1 cut(s) 80
BstBI TTCGAA 1 cut(s) 83
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 2 cut(s) 207, 256
BstF5I GGATG 2 cut(s) 174, 564
BstKTI GATC 2 cut(s) 327, 568
BstMAI GTCTC 2 cut(s) 22, 523
BstMBI GATC 2 cut(s) 324, 565
BstMWI GCNNNNNNNGC 2 cut(s) 29, 467
BstNI CCWGG 3 cut(s) 51, 368, 551
BstSCI CCNGG 5 cut(s) 49, 366, 450, 549, 554
BstX2I RGATCY 1 cut(s) 324
BstXI CCANNNNNNTGG 1 cut(s) 65
BstYI RGATCY 1 cut(s) 324
BsuRI GGCC 3 cut(s) 32, 104, 554
BtsCI GGATG 2 cut(s) 174, 564
BtsIMutI CAGTG 3 cut(s) 256, 512, 631
Cac8I GCNNGC 1 cut(s) 6
Cfr10I RCCGGY 2 cut(s) 475, 611
Csp6I GTAC 3 cut(s) 299, 416, 499
CspAI ACCGGT 1 cut(s) 611
CviAII CATG 2 cut(s) 120, 472
CviQI GTAC 3 cut(s) 299, 416, 499
DdeI CTNAG 2 cut(s) 207, 256
DpnI GATC 2 cut(s) 326, 567
DpnII GATC 2 cut(s) 324, 565
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
EciI GGCGGA 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 64
Eco31I GGTCTC 2 cut(s) 22, 523
Eco57I CTGAAG 2 cut(s) 47, 607
Eco88I CYCGRG 1 cut(s) 98
EcoRII CCWGG 3 cut(s) 49, 366, 549
EcoT14I CCWWGG 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 64
FaeI CATG 2 cut(s) 123, 475
FaiI YATR 3 cut(s) 47, 121, 473
FalI AAGNNNNNCTT 2 cut(s) 402, 434
FaqI GGGAC 2 cut(s) 55, 137
FatI CATG 2 cut(s) 119, 471
FokI GGATG 2 cut(s) 161, 571
FspBI CTAG 1 cut(s) 602
GsuI CTGGAG 1 cut(s) 483
HaeIII GGCC 3 cut(s) 32, 104, 554
HapII CCGG 4 cut(s) 452, 476, 555, 612
Hin1II CATG 2 cut(s) 123, 475
HinfI GANTC 7 cut(s) 54, 69, 80, 182, 203, 384, 575
HpaII CCGG 4 cut(s) 452, 476, 555, 612
HphI GGTGA 4 cut(s) 173, 356, 500, 538
Hpy166II GTNNAC 1 cut(s) 546
Hpy188I TCNGA 4 cut(s) 339, 349, 383, 570
Hpy188III TCNNGA 3 cut(s) 209, 445, 579
Hpy8I GTNNAC 1 cut(s) 546
HpyAV CCTTC 4 cut(s) 22, 404, 417, 631
HpyCH4III ACNGT 4 cut(s) 251, 356, 378, 392
HpyCH4V TGCA 2 cut(s) 609, 645
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 467
HpyF3I CTNAG 2 cut(s) 207, 256
Hsp92II CATG 2 cut(s) 123, 475
KpnI GGTACC 1 cut(s) 302
Kzo9I GATC 2 cut(s) 324, 565
LmnI GCTCC 1 cut(s) 166
MaeI CTAG 1 cut(s) 602
MaeIII GTNAC 3 cut(s) 259, 304, 614
MalI GATC 2 cut(s) 326, 567
MboI GATC 2 cut(s) 324, 565
MboII GAAGA 2 cut(s) 67, 326
MflI RGATCY 1 cut(s) 324
MluCI AATT 2 cut(s) 282, 331
MlyI GAGTC 1 cut(s) 63
MmeI TCCRAC 2 cut(s) 463, 543
MnlI CCTC 5 cut(s) 83, 94, 157, 225, 479
MroXI GAANNNNTTC 1 cut(s) 89
MspI CCGG 4 cut(s) 452, 476, 555, 612
MspR9I CCNGG 5 cut(s) 51, 368, 452, 551, 556
MvaI CCWGG 3 cut(s) 51, 368, 551
MwoI GCNNNNNNNGC 2 cut(s) 29, 467
NciI CCSGG 2 cut(s) 452, 556
NdeII GATC 2 cut(s) 324, 565
NlaIII CATG 2 cut(s) 123, 475
NlaIV GGNNCC 1 cut(s) 300
NmuCI GTSAC 2 cut(s) 259, 304
NspV TTCGAA 1 cut(s) 83
PaeR7I CTCGAG 1 cut(s) 98
PdmI GAANNNNTTC 1 cut(s) 89
PfeI GAWTC 6 cut(s) 54, 80, 182, 203, 384, 575
PinAI ACCGGT 1 cut(s) 611
PleI GAGTC 1 cut(s) 63
PpsI GAGTC 1 cut(s) 63
Psp6I CCWGG 3 cut(s) 49, 366, 549
PspGI CCWGG 3 cut(s) 49, 366, 549
PspN4I GGNNCC 1 cut(s) 300
PspXI VCTCGAGB 1 cut(s) 98
PsuI RGATCY 1 cut(s) 324
RsaI GTAC 3 cut(s) 300, 417, 500
RsaNI GTAC 3 cut(s) 299, 416, 499
Sau3AI GATC 2 cut(s) 324, 565
ScaI AGTACT 1 cut(s) 417
SchI GAGTC 1 cut(s) 63
ScrFI CCNGG 5 cut(s) 51, 368, 452, 551, 556
SetI ASST 9 cut(s) 52, 92, 171, 280, 304, 369, 490, 603, 623
Sfr274I CTCGAG 1 cut(s) 98
SfuI TTCGAA 1 cut(s) 83
SlaI CTCGAG 1 cut(s) 98
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 282, 331
SsiI CCGC 2 cut(s) 21, 524
SspMI CTAG 1 cut(s) 602
StyD4I CCNGG 5 cut(s) 49, 366, 450, 549, 554
StyI CCWWGG 1 cut(s) 64
TaaI ACNGT 4 cut(s) 251, 356, 378, 392
TaqI TCGA 4 cut(s) 78, 83, 99, 239
TasI AATT 2 cut(s) 282, 331
TatI WGTACW 2 cut(s) 415, 498
TfiI GAWTC 6 cut(s) 54, 80, 182, 203, 384, 575
TscAI CASTG 3 cut(s) 256, 519, 631
TseFI GTSAC 2 cut(s) 259, 304
Tsp45I GTSAC 2 cut(s) 259, 304
TspGWI ACGGA 2 cut(s) 587, 609
TspRI CASTG 3 cut(s) 256, 519, 631
XapI RAATTY 1 cut(s) 282
XcmI CCANNNNNNNNNTGG 1 cut(s) 117
XhoI CTCGAG 1 cut(s) 98
XmnI GAANNNNTTC 1 cut(s) 89
XspI CTAG 1 cut(s) 602
ZrmI AGTACT 1 cut(s) 417
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.