Rmu_sc0005599.1_g000032
ERF Family

BEST Arabidopsis thaliana protein match is alpha beta-Hydrolases superfamily protein (TAIR

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005599.1
Physical Location & Seq
Reverse (-)
138059 .. 139975
1917 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005599.1_g000032.1.cds

Sequence Viewer

Length: 411 bp
ctgatctacacaggaacgagagtgctgcaggggcagcaggcgtgcgactatgctgcaggggcagtgggggctgcagggaggctgcggcaagggcagcagggactgcagggaggctgcggcagaggaggttttttctggttagggcttgggttagaaggcgcgactcgtggtagtgatgtggagatgtcaaatctggaggaagaggaggactggaaattggggctttcaatggtggaagctcggaggaggagggtcttctttcgggttcgagctggttatggcgaaagtgatccgtatccctcacgcccagttaagagtgaagcatatgatattcaagaactagccgagacgttgcagattgggtccaaattctatgtaattggaatctcaatggcggcttaccctctttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

136

Amino Acids

14.83

Weight (kDa)

5.53

Isoelectric Point (pI)

64.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018929)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 161
AciI CCGC 3 cut(s) 85, 117, 395
AclWI GGATC 1 cut(s) 284
AcsI RAATTY 1 cut(s) 368
AgsI TTSAA 2 cut(s) 228, 335
AluBI AGCT 2 cut(s) 239, 272
AluI AGCT 2 cut(s) 239, 272
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 1 cut(s) 284
AlwNI CAGNNNCTG 1 cut(s) 103
ApeKI GCWGC 7 cut(s) 25, 34, 53, 71, 82, 94, 114
ApoI RAATTY 1 cut(s) 368
AspLEI GCGC 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 363
AvaII GGWCC 1 cut(s) 363
BauI CACGAG 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 247
BbvI GCAGC 7 cut(s) 12, 40, 46, 58, 69, 101, 106
BcgI CGANNNNNNTGC 4 cut(s) 7, 35, 41, 69
BciVI GTATCC 1 cut(s) 306
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 1 cut(s) 341
BfmI CTRYAG 4 cut(s) 26, 54, 72, 104
BfuI GTATCC 1 cut(s) 306
Bme18I GGWCC 1 cut(s) 363
BmgT120I GGNCC 1 cut(s) 363
BmiI GGNNCC 1 cut(s) 364
BmrI ACTGGG 1 cut(s) 302
BmuI ACTGGG 1 cut(s) 302
BpiI GAAGAC 1 cut(s) 247
BpmI CTGGAG 1 cut(s) 215
BsaBI GATNNNNATC 1 cut(s) 294
Bse1I ACTGG 2 cut(s) 215, 308
Bse8I GATNNNNATC 1 cut(s) 294
BseJI GATNNNNATC 1 cut(s) 294
BseNI ACTGG 2 cut(s) 215, 308
BseRI GAGGAG 4 cut(s) 138, 218, 259, 262
BseXI GCAGC 7 cut(s) 12, 40, 46, 58, 69, 101, 106
Bsh1236I CGCG 1 cut(s) 161
BslFI GGGAC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 341
BsmBI CGTCTC 1 cut(s) 341
BsmFI GGGAC 1 cut(s) 114
Bsp143I GATC 2 cut(s) 3, 289
BspACI CCGC 3 cut(s) 85, 117, 395
BspFNI CGCG 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 364
BspMAI CTGCAG 4 cut(s) 30, 58, 76, 108
BspPI GGATC 1 cut(s) 284
BsrI ACTGG 2 cut(s) 215, 308
BssMI GATC 2 cut(s) 3, 289
BssSI CACGAG 1 cut(s) 165
Bst2BI CACGAG 1 cut(s) 165
Bst6I CTCTTC 1 cut(s) 195
BstAPI GCANNNNNTGC 1 cut(s) 103
BstC8I GCNNGC 2 cut(s) 39, 43
BstFNI CGCG 1 cut(s) 161
BstHHI GCGC 1 cut(s) 161
BstKTI GATC 2 cut(s) 6, 292
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 2 cut(s) 3, 289
BstMWI GCNNNNNNNGC 7 cut(s) 31, 34, 59, 68, 91, 94, 103
BstSFI CTRYAG 4 cut(s) 26, 54, 72, 104
BstUI CGCG 1 cut(s) 161
BstV1I GCAGC 7 cut(s) 12, 40, 46, 58, 69, 101, 106
BstV2I GAAGAC 1 cut(s) 247
BsuI GTATCC 1 cut(s) 306
BtsI GCAGTG 1 cut(s) 69
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 2 cut(s) 39, 43
CaiI CAGNNNCTG 1 cut(s) 103
CfoI GCGC 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 363
CviJI RGCY 9 cut(s) 71, 82, 114, 145, 223, 239, 272, 344, 398
CviKI_1 RGCY 9 cut(s) 71, 82, 114, 145, 223, 239, 272, 344, 398
DpnI GATC 2 cut(s) 5, 291
DpnII GATC 2 cut(s) 3, 289
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco47I GGWCC 1 cut(s) 363
Esp3I CGTCTC 1 cut(s) 341
FaiI YATR 5 cut(s) 51, 279, 325, 327, 375
FaqI GGGAC 1 cut(s) 114
FauNDI CATATG 1 cut(s) 325
FspBI CTAG 1 cut(s) 341
GlaI GCGC 1 cut(s) 160
GsuI CTGGAG 1 cut(s) 215
HhaI GCGC 1 cut(s) 161
Hin6I GCGC 1 cut(s) 159
HinP1I GCGC 1 cut(s) 159
HinfI GANTC 2 cut(s) 163, 384
Hpy188I TCNGA 1 cut(s) 243
Hpy188III TCNNGA 2 cut(s) 194, 335
HpyAV CCTTC 1 cut(s) 149
HpyCH4IV ACGT 1 cut(s) 350
HpyCH4V TGCA 5 cut(s) 28, 56, 74, 106, 355
HpyF10VI GCNNNNNNNGC 7 cut(s) 31, 34, 59, 68, 91, 94, 103
HpySE526I ACGT 1 cut(s) 350
HspAI GCGC 1 cut(s) 159
Kzo9I GATC 2 cut(s) 3, 289
Lsp1109I GCAGC 7 cut(s) 12, 40, 46, 58, 69, 101, 106
MaeI CTAG 1 cut(s) 341
MaeII ACGT 1 cut(s) 350
MalI GATC 2 cut(s) 5, 291
MboI GATC 2 cut(s) 3, 289
MboII GAAGA 2 cut(s) 212, 247
MluCI AATT 3 cut(s) 215, 368, 378
MlyI GAGTC 1 cut(s) 157
MseI TTAA 1 cut(s) 312
MvnI CGCG 1 cut(s) 161
MwoI GCNNNNNNNGC 7 cut(s) 31, 34, 59, 68, 91, 94, 103
NdeI CATATG 1 cut(s) 325
NdeII GATC 2 cut(s) 3, 289
NlaIV GGNNCC 1 cut(s) 364
NmeAIII GCCGAG 1 cut(s) 370
PfeI GAWTC 1 cut(s) 384
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PspN4I GGNNCC 1 cut(s) 364
PspPI GGNCC 1 cut(s) 363
PstI CTGCAG 4 cut(s) 30, 58, 76, 108
PstNI CAGNNNCTG 1 cut(s) 103
SaqAI TTAA 1 cut(s) 312
Sau3AI GATC 2 cut(s) 3, 289
Sau96I GGNCC 1 cut(s) 363
SchI GAGTC 1 cut(s) 157
SetI ASST 4 cut(s) 130, 241, 274, 353
SfcI CTRYAG 4 cut(s) 26, 54, 72, 104
SinI GGWCC 1 cut(s) 363
Sse9I AATT 3 cut(s) 215, 368, 378
SsiI CCGC 3 cut(s) 85, 117, 395
SspMI CTAG 1 cut(s) 341
TaiI ACGT 1 cut(s) 353
TaqI TCGA 1 cut(s) 268
TasI AATT 3 cut(s) 215, 368, 378
TauI GCSGC 3 cut(s) 88, 120, 398
TfiI GAWTC 1 cut(s) 384
Tru1I TTAA 1 cut(s) 312
Tru9I TTAA 1 cut(s) 312
TscAI CASTG 1 cut(s) 69
TseI GCWGC 7 cut(s) 25, 34, 53, 71, 82, 94, 114
TspGWI ACGGA 1 cut(s) 282
TspRI CASTG 1 cut(s) 69
VpaK11BI GGWCC 1 cut(s) 363
XapI RAATTY 1 cut(s) 368
XspI CTAG 1 cut(s) 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.