Rh2BG389400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
55368986 .. 55378458
9473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG389400.1

Sequence Viewer

Length: 267 bp
ATGGTGCAAATCACATCTAGAACCAAAATCTACAGTAACTTGCTCCATGAGCTTAAACGAAATCAAATACGAACAGAAATCTGCAAAATACTAGCATCAGGTCATGCCAGCACCTCAACTTCCAGAGGCGCGACTCGTGCCAGCGATGTGGAGATGTCAAGTCTGGAGGAGGAGGAGGACTGGACTTTGGGGCTTTTAATGGTGGAAGGCTTGGAGGAGGAGGGTCTTCGTTCGGGTTCGGTAGTGCAACTACTGGCTCGGATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.79

Weight (kDa)

5.33

Isoelectric Point (pI)

53.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018929)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 131
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AspLEI GCGC 1 cut(s) 131
BauI CACGAG 1 cut(s) 135
BbsI GAAGAC 1 cut(s) 218
BfaI CTAG 2 cut(s) 18, 92
BfmI CTRYAG 1 cut(s) 31
BmsI GCATC 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 218
BpmI CTGGAG 1 cut(s) 185
Bse1I ACTGG 2 cut(s) 185, 258
BseGI GGATG 1 cut(s) 267
BseNI ACTGG 2 cut(s) 185, 258
BseRI GAGGAG 5 cut(s) 182, 185, 188, 230, 233
Bsh1236I CGCG 1 cut(s) 131
BspFNI CGCG 1 cut(s) 131
BsrI ACTGG 2 cut(s) 185, 258
BssSI CACGAG 1 cut(s) 135
Bst2BI CACGAG 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 35
BstC8I GCNNGC 2 cut(s) 109, 142
BstF5I GGATG 1 cut(s) 267
BstFNI CGCG 1 cut(s) 131
BstHHI GCGC 1 cut(s) 131
BstMWI GCNNNNNNNGC 2 cut(s) 49, 137
BstSFI CTRYAG 1 cut(s) 31
BstUI CGCG 1 cut(s) 131
BstV2I GAAGAC 1 cut(s) 218
BstXI CCANNNNNNTGG 1 cut(s) 148
BtgZI GCGATG 1 cut(s) 159
BtsCI GGATG 1 cut(s) 267
Cac8I GCNNGC 2 cut(s) 109, 142
CfoI GCGC 1 cut(s) 131
CviAII CATG 2 cut(s) 47, 104
CviJI RGCY 4 cut(s) 52, 193, 210, 257
CviKI_1 RGCY 4 cut(s) 52, 193, 210, 257
FaeI CATG 2 cut(s) 50, 107
FaiI YATR 2 cut(s) 48, 105
FatI CATG 2 cut(s) 46, 103
FspBI CTAG 2 cut(s) 18, 92
GlaI GCGC 1 cut(s) 130
GsuI CTGGAG 1 cut(s) 185
HhaI GCGC 1 cut(s) 131
Hin1II CATG 2 cut(s) 50, 107
Hin6I GCGC 1 cut(s) 129
HinP1I GCGC 1 cut(s) 129
HinfI GANTC 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 3 cut(s) 18, 123, 164
HpyAV CCTTC 1 cut(s) 200
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 3 cut(s) 7, 84, 247
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 137
Hsp92II CATG 2 cut(s) 50, 107
HspAI GCGC 1 cut(s) 129
LmnI GCTCC 1 cut(s) 48
LpnPI CCDG 7 cut(s) 84, 121, 136, 149, 154, 166, 239
LweI GCATC 1 cut(s) 104
MaeI CTAG 2 cut(s) 18, 92
MaeIII GTNAC 1 cut(s) 35
MboII GAAGA 1 cut(s) 218
MlyI GAGTC 1 cut(s) 127
MnlI CCTC 9 cut(s) 119, 124, 160, 163, 166, 169, 208, 211, 214
MseI TTAA 2 cut(s) 54, 197
MvnI CGCG 1 cut(s) 131
MwoI GCNNNNNNNGC 2 cut(s) 49, 137
NlaIII CATG 2 cut(s) 50, 107
PleI GAGTC 1 cut(s) 127
PpsI GAGTC 1 cut(s) 127
SaqAI TTAA 2 cut(s) 54, 197
SchI GAGTC 1 cut(s) 127
SetI ASST 3 cut(s) 54, 103, 116
SfaNI GCATC 1 cut(s) 104
SfcI CTRYAG 1 cut(s) 31
SspMI CTAG 2 cut(s) 18, 92
TaaI ACNGT 1 cut(s) 35
Tru1I TTAA 2 cut(s) 54, 197
Tru9I TTAA 2 cut(s) 54, 197
XbaI TCTAGA 1 cut(s) 17
XspI CTAG 2 cut(s) 18, 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.