Rh2CG369100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
50161614 .. 50173318
11705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG369100.1

Sequence Viewer

Length: 267 bp
ATGCCCTATTTAGTGAAAAAAAGGACAACTATGGTGCAAATCACATCTAGAACCAAAATCTACAGTAACTTGCTCCATGAGCTTAAACGAAATCAAATACGAACAGAAATCTGCAAAATACTAGCATCAGGTTCGGATGCAACGAGCATAACTTTGCTAGCAGAATGGAATGTTTTAGATGCAATGCCCCAAGAGACACATACTAGAGAGAAGAAATTCTTAATAATCCAATTTTTGGCATTGCTGCTGAGCGAGAAAGAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.23

Weight (kDa)

9.61

Isoelectric Point (pI)

37.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018929)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 235
AcsI RAATTY 1 cut(s) 215
AfiI CCNNNNNNNGG 1 cut(s) 235
AluBI AGCT 1 cut(s) 82
AluI AGCT 1 cut(s) 82
Alw26I GTCTC 1 cut(s) 188
ApeKI GCWGC 1 cut(s) 244
ApoI RAATTY 1 cut(s) 215
Asp700I GAANNNNTTC 1 cut(s) 215
AsuNHI GCTAGC 1 cut(s) 157
BbvI GCAGC 1 cut(s) 231
BcgI CGANNNNNNTGC 2 cut(s) 114, 148
BcoDI GTCTC 1 cut(s) 188
BfaI CTAG 4 cut(s) 48, 122, 158, 204
BfmI CTRYAG 1 cut(s) 61
BisI GCNGC 1 cut(s) 245
BlpI GCTNAGC 1 cut(s) 248
BlsI GCNGC 1 cut(s) 246
BmsI GCATC 3 cut(s) 127, 134, 169
BmtI GCTAGC 1 cut(s) 161
Bpu1102I GCTNAGC 1 cut(s) 248
Bsc4I CCNNNNNNNGG 1 cut(s) 235
Bse3DI GCAATG 2 cut(s) 189, 239
BseGI GGATG 1 cut(s) 142
BseLI CCNNNNNNNGG 1 cut(s) 235
BseMI GCAATG 2 cut(s) 189, 239
BseMII CTCAG 1 cut(s) 239
BseXI GCAGC 1 cut(s) 231
BslI CCNNNNNNNGG 1 cut(s) 235
BsmAI GTCTC 1 cut(s) 188
Bsp1720I GCTNAGC 1 cut(s) 248
BspCNI CTCAG 1 cut(s) 240
BspOI GCTAGC 1 cut(s) 161
BsrDI GCAATG 2 cut(s) 189, 239
Bst4CI ACNGT 1 cut(s) 65
BstC8I GCNNGC 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 248
BstF5I GGATG 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 188
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 61
BstV1I GCAGC 1 cut(s) 231
BtsCI GGATG 1 cut(s) 142
Cac8I GCNNGC 1 cut(s) 159
CviAII CATG 1 cut(s) 77
CviJI RGCY 1 cut(s) 82
CviKI_1 RGCY 1 cut(s) 82
DdeI CTNAG 1 cut(s) 248
FaeI CATG 1 cut(s) 80
FaiI YATR 4 cut(s) 32, 78, 149, 201
FalI AAGNNNNNCTT 2 cut(s) 203, 235
FatI CATG 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 245
FokI GGATG 1 cut(s) 149
Fsp4HI GCNGC 1 cut(s) 245
FspBI CTAG 4 cut(s) 48, 122, 158, 204
GluI GCNGC 1 cut(s) 245
Hin1II CATG 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4V TGCA 4 cut(s) 37, 114, 140, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 248
Hsp92II CATG 1 cut(s) 80
LmnI GCTCC 1 cut(s) 78
LpnPI CCDG 1 cut(s) 114
Lsp1109I GCAGC 1 cut(s) 231
LweI GCATC 3 cut(s) 127, 134, 169
MaeI CTAG 4 cut(s) 48, 122, 158, 204
MaeIII GTNAC 1 cut(s) 65
MboII GAAGA 1 cut(s) 223
MluCI AATT 2 cut(s) 215, 230
MroXI GAANNNNTTC 1 cut(s) 215
MseI TTAA 2 cut(s) 84, 221
MwoI GCNNNNNNNGC 1 cut(s) 79
NheI GCTAGC 1 cut(s) 157
NlaIII CATG 1 cut(s) 80
PcsI WCGNNNNNNNCGW 1 cut(s) 140
PdmI GAANNNNTTC 1 cut(s) 215
PflMI CCANNNNNTGG 1 cut(s) 235
PkrI GCNGC 1 cut(s) 246
SaqAI TTAA 2 cut(s) 84, 221
SatI GCNGC 1 cut(s) 245
SetI ASST 2 cut(s) 84, 133
SfaNI GCATC 3 cut(s) 127, 134, 169
SfcI CTRYAG 1 cut(s) 61
SgeI CNNG 9 cut(s) 60, 82, 89, 134, 141, 156, 170, 203, 216
Sse9I AATT 2 cut(s) 215, 230
SspMI CTAG 4 cut(s) 48, 122, 158, 204
TaaI ACNGT 1 cut(s) 65
TasI AATT 2 cut(s) 215, 230
Tru1I TTAA 2 cut(s) 84, 221
Tru9I TTAA 2 cut(s) 84, 221
TseI GCWGC 1 cut(s) 244
Van91I CCANNNNNTGG 1 cut(s) 235
XapI RAATTY 1 cut(s) 215
XbaI TCTAGA 1 cut(s) 47
XmnI GAANNNNTTC 1 cut(s) 215
XspI CTAG 4 cut(s) 48, 122, 158, 204
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.