Rmu_sc0005702.1_g000001

UDP-arabinose 4-epimerase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005702.1
Physical Location & Seq
Reverse (-)
518 .. 3090
2573 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005702.1_g000001.1.cds

Sequence Viewer

Length: 753 bp
atgctaaattttgccaggggcagacgagagtcacggtccaatagacccctgtcgcttggaggcatggattacccagatcccaagaggaagaacaattttgtaggaaaaattattttggctgctgcccttacggcgctatgcattatcatgctgaaacaatccccatcgttcaatcctactagcacgttctcccgtcgtgaatcaggagtaacccatgtcctagtaacgggaggtgctggatatattggttcacatgctgcattacgacttctaaaggattcataccgtgtaactattgtggataacctctcacggggaaacctaggtgcagtcaaggttctccaacaactatttcctgagcctgggaggctgcaatttatttatgctgacttgggggatccaaaatccgttaacaaaatattttcagagaatgcatttgatgctgtgatgcattttgcagctgtagcatatgtcggggaaagcacccttgatccacttaagtattaccacaatattacatcaaataccttggtagtagtagaggcgatggccaaacatcgtgtgaggacattaatatattctagcacatgtgcaacatatggagaaccggaaaagatgcctattactgaagaaactacacaggtcccaattaatccatatggaaaagctaagaagatggcagaggatattatcctggatttctctaagaattcaaacatggcagtcatgatcctgaggttggtgctttattag

Protein Analysis

250

Amino Acids

27.68

Weight (kDa)

9.52

Isoelectric Point (pI)

47.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020218)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G30620
pyrus_communis pycom17g11960 pycom17g11970
rosa_multiflora Rmu_sc0005702.1_g000001 Rmu_sc0022928.1_g000001
rosa_wichuraiana Rw2G041570

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 71, 392, 405, 485, 724
AcoI YGGCCR 1 cut(s) 549
AcsI RAATTY 2 cut(s) 7, 709
AcuI CTGAAG 1 cut(s) 648
AfiI CCNNNNNNNGG 4 cut(s) 226, 313, 362, 739
AflII CTTAAG 1 cut(s) 497
AflIII ACRYGT 1 cut(s) 587
AgsI TTSAA 2 cut(s) 172, 714
AjnI CCWGG 3 cut(s) 14, 361, 693
AjuI GAANNNNNNNTTGG 2 cut(s) 336, 368
AluBI AGCT 2 cut(s) 461, 668
AluI AGCT 2 cut(s) 461, 668
AlwI GGATC 5 cut(s) 71, 392, 405, 485, 724
AoxI GGCC 1 cut(s) 549
ApeKI GCWGC 5 cut(s) 119, 122, 257, 370, 458
ApoI RAATTY 2 cut(s) 7, 709
AseI ATTAAT 2 cut(s) 572, 651
AspA2I CCTAGG 1 cut(s) 322
AspLEI GCGC 1 cut(s) 136
AspS9I GGNCC 2 cut(s) 36, 643
AvaII GGWCC 2 cut(s) 36, 643
AvrII CCTAGG 1 cut(s) 322
AxyI CCTNAGG 1 cut(s) 734
BalI TGGCCA 1 cut(s) 551
BamHI GGATCC 1 cut(s) 397
BbvI GCAGC 5 cut(s) 106, 109, 244, 357, 470
BccI CCATC 3 cut(s) 172, 541, 670
BceAI ACGGC 1 cut(s) 147
BciT130I CCWGG 3 cut(s) 16, 363, 695
BfaI CTAG 4 cut(s) 180, 221, 323, 582
BfmI CTRYAG 1 cut(s) 462
BfoI RGCGCY 1 cut(s) 137
BfrI CTTAAG 1 cut(s) 497
BglI GCCNNNNNGGC 2 cut(s) 131, 367
BisI GCNGC 5 cut(s) 120, 123, 258, 371, 459
BlnI CCTAGG 1 cut(s) 322
BlsI GCNGC 5 cut(s) 121, 124, 259, 372, 460
Bme1390I CCNGG 3 cut(s) 16, 363, 695
Bme18I GGWCC 2 cut(s) 36, 643
BmgT120I GGNCC 2 cut(s) 36, 643
BmiI GGNNCC 2 cut(s) 399, 645
BmrFI CCNGG 3 cut(s) 16, 363, 695
BmsI GCATC 3 cut(s) 430, 438, 606
BoxI GACNNNNGTC 2 cut(s) 28, 49
Bpu10I CCTNAGC 1 cut(s) 357
BsaJI CCNNGG 4 cut(s) 15, 322, 362, 528
BsaWI WCCGGW 1 cut(s) 607
Bsc4I CCNNNNNNNGG 4 cut(s) 226, 313, 362, 739
Bse21I CCTNAGG 1 cut(s) 734
BseBI CCWGG 3 cut(s) 16, 363, 695
BseDI CCNNGG 4 cut(s) 15, 322, 362, 528
BseLI CCNNNNNNNGG 4 cut(s) 226, 313, 362, 739
BseMII CTCAG 2 cut(s) 348, 725
BseXI GCAGC 5 cut(s) 106, 109, 244, 357, 470
BsgI GTGCAG 1 cut(s) 348
BshFI GGCC 1 cut(s) 551
BsiSI CCGG 1 cut(s) 608
BslFI GGGAC 1 cut(s) 629
BslI CCNNNNNNNGG 4 cut(s) 226, 313, 362, 739
BsmFI GGGAC 1 cut(s) 629
BsmI GAATGC 1 cut(s) 436
BsnI GGCC 1 cut(s) 551
Bsp143I GATC 4 cut(s) 76, 397, 490, 729
BspANI GGCC 1 cut(s) 551
BspCNI CTCAG 2 cut(s) 349, 726
BspHI TCATGA 1 cut(s) 726
BspLI GGNNCC 2 cut(s) 399, 645
BspPI GGATC 5 cut(s) 71, 392, 405, 485, 724
BspTI CTTAAG 1 cut(s) 497
BssECI CCNNGG 4 cut(s) 15, 322, 362, 528
BssMI GATC 4 cut(s) 76, 397, 490, 729
BssT1I CCWWGG 2 cut(s) 322, 528
Bst2UI CCWGG 3 cut(s) 16, 363, 695
Bst4CI ACNGT 2 cut(s) 36, 287
BstAFI CTTAAG 1 cut(s) 497
BstAPI GCANNNNNTGC 1 cut(s) 440
BstDEI CTNAG 4 cut(s) 357, 669, 705, 734
BstH2I RGCGCY 1 cut(s) 137
BstHHI GCGC 1 cut(s) 136
BstKTI GATC 4 cut(s) 79, 400, 493, 732
BstMBI GATC 4 cut(s) 76, 397, 490, 729
BstMWI GCNNNNNNNGC 4 cut(s) 131, 367, 440, 464
BstNI CCWGG 3 cut(s) 16, 363, 695
BstNSI RCATGY 2 cut(s) 257, 591
BstPAI GACNNNNGTC 2 cut(s) 28, 49
BstSCI CCNGG 3 cut(s) 14, 361, 693
BstSFI CTRYAG 1 cut(s) 462
BstV1I GCAGC 5 cut(s) 106, 109, 244, 357, 470
BstX2I RGATCY 2 cut(s) 76, 397
BstYI RGATCY 2 cut(s) 76, 397
Bsu36I CCTNAGG 1 cut(s) 734
BsuRI GGCC 1 cut(s) 551
BtgZI GCGATG 1 cut(s) 560
CciI TCATGA 1 cut(s) 726
CfoI GCGC 1 cut(s) 136
Cfr13I GGNCC 2 cut(s) 36, 643
CviAII CATG 7 cut(s) 64, 148, 215, 254, 588, 718, 727
CviJI RGCY 6 cut(s) 119, 361, 370, 461, 551, 668
CviKI_1 RGCY 6 cut(s) 119, 361, 370, 461, 551, 668
DdeI CTNAG 4 cut(s) 357, 669, 705, 734
DpnI GATC 4 cut(s) 78, 399, 492, 731
DpnII GATC 4 cut(s) 76, 397, 490, 729
EaeI YGGCCR 1 cut(s) 549
Eco130I CCWWGG 2 cut(s) 322, 528
Eco47I GGWCC 2 cut(s) 36, 643
Eco57I CTGAAG 1 cut(s) 648
Eco81I CCTNAGG 1 cut(s) 734
EcoO109I RGGNCCY 1 cut(s) 643
EcoRI GAATTC 1 cut(s) 709
EcoRII CCWGG 3 cut(s) 14, 361, 693
EcoT14I CCWWGG 2 cut(s) 322, 528
EcoT22I ATGCAT 3 cut(s) 143, 436, 453
ErhI CCWWGG 2 cut(s) 322, 528
FaeI CATG 7 cut(s) 67, 151, 218, 257, 591, 721, 730
FaqI GGGAC 1 cut(s) 629
FatI CATG 7 cut(s) 63, 147, 214, 253, 587, 717, 726
FauNDI CATATG 3 cut(s) 469, 598, 658
Fnu4HI GCNGC 5 cut(s) 120, 123, 258, 371, 459
Fsp4HI GCNGC 5 cut(s) 120, 123, 258, 371, 459
FspBI CTAG 4 cut(s) 180, 221, 323, 582
GlaI GCGC 1 cut(s) 135
GluI GCNGC 5 cut(s) 120, 123, 258, 371, 459
HaeII RGCGCY 1 cut(s) 137
HaeIII GGCC 1 cut(s) 551
HapII CCGG 1 cut(s) 608
HhaI GCGC 1 cut(s) 136
Hin1II CATG 7 cut(s) 67, 151, 218, 257, 591, 721, 730
Hin6I GCGC 1 cut(s) 134
HinP1I GCGC 1 cut(s) 134
HincII GTYRAC 1 cut(s) 412
HindII GTYRAC 1 cut(s) 412
HinfI GANTC 3 cut(s) 29, 200, 278
HpaI GTTAAC 1 cut(s) 412
HpaII CCGG 1 cut(s) 608
Hpy166II GTNNAC 2 cut(s) 251, 412
Hpy188I TCNGA 1 cut(s) 427
Hpy188III TCNNGA 5 cut(s) 197, 204, 356, 727, 733
Hpy8I GTNNAC 2 cut(s) 251, 412
Hpy99I CGWCG 1 cut(s) 198
HpyCH4III ACNGT 2 cut(s) 36, 287
HpyCH4IV ACGT 1 cut(s) 185
HpyCH4V TGCA 8 cut(s) 141, 260, 329, 373, 434, 451, 458, 593
HpyF10VI GCNNNNNNNGC 4 cut(s) 131, 367, 440, 464
HpyF3I CTNAG 4 cut(s) 357, 669, 705, 734
HpySE526I ACGT 1 cut(s) 185
Hsp92II CATG 7 cut(s) 67, 151, 218, 257, 591, 721, 730
HspAI GCGC 1 cut(s) 134
KspAI GTTAAC 1 cut(s) 412
Kzo9I GATC 4 cut(s) 76, 397, 490, 729
Lsp1109I GCAGC 5 cut(s) 106, 109, 244, 357, 470
LweI GCATC 3 cut(s) 430, 438, 606
MaeI CTAG 4 cut(s) 180, 221, 323, 582
MaeII ACGT 1 cut(s) 185
MaeIII GTNAC 4 cut(s) 30, 208, 223, 289
MalI GATC 4 cut(s) 78, 399, 492, 731
MboI GATC 4 cut(s) 76, 397, 490, 729
MboII GAAGA 3 cut(s) 100, 641, 685
MflI RGATCY 2 cut(s) 76, 397
MlsI TGGCCA 1 cut(s) 551
MluCI AATT 6 cut(s) 7, 94, 108, 374, 648, 709
MluNI TGGCCA 1 cut(s) 551
MlyI GAGTC 1 cut(s) 38
MmeI TCCRAC 1 cut(s) 367
MnlI CCTC 9 cut(s) 53, 78, 224, 317, 360, 535, 558, 676, 729
Mox20I TGGCCA 1 cut(s) 551
Mph1103I ATGCAT 3 cut(s) 143, 436, 453
MscI TGGCCA 1 cut(s) 551
MseI TTAA 4 cut(s) 411, 498, 572, 651
MslI CAYNNNNRTG 1 cut(s) 146
Msp20I TGGCCA 1 cut(s) 551
MspA1I CMGCKG 1 cut(s) 461
MspCI CTTAAG 1 cut(s) 497
MspI CCGG 1 cut(s) 608
MspR9I CCNGG 3 cut(s) 16, 363, 695
Mva1269I GAATGC 1 cut(s) 436
MvaI CCWGG 3 cut(s) 16, 363, 695
MwoI GCNNNNNNNGC 4 cut(s) 131, 367, 440, 464
NdeI CATATG 3 cut(s) 469, 598, 658
NdeII GATC 4 cut(s) 76, 397, 490, 729
NlaIII CATG 7 cut(s) 67, 151, 218, 257, 591, 721, 730
NlaIV GGNNCC 2 cut(s) 399, 645
NmuCI GTSAC 1 cut(s) 30
NsiI ATGCAT 3 cut(s) 143, 436, 453
NspI RCATGY 2 cut(s) 257, 591
PagI TCATGA 1 cut(s) 726
PciI ACATGT 1 cut(s) 587
PctI GAATGC 1 cut(s) 436
PfeI GAWTC 2 cut(s) 200, 278
PfoI TCCNGGA 1 cut(s) 693
PkrI GCNGC 5 cut(s) 121, 124, 259, 372, 460
PleI GAGTC 1 cut(s) 37
PpsI GAGTC 1 cut(s) 37
PpuMI RGGWCCY 1 cut(s) 643
PscI ACATGT 1 cut(s) 587
PshAI GACNNNNGTC 2 cut(s) 28, 49
PshBI ATTAAT 2 cut(s) 572, 651
Psp5II RGGWCCY 1 cut(s) 643
Psp6I CCWGG 3 cut(s) 14, 361, 693
PspGI CCWGG 3 cut(s) 14, 361, 693
PspN4I GGNNCC 2 cut(s) 399, 645
PspPI GGNCC 2 cut(s) 36, 643
PspPPI RGGWCCY 1 cut(s) 643
PsuI RGATCY 2 cut(s) 76, 397
PvuII CAGCTG 1 cut(s) 461
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 4 cut(s) 411, 498, 572, 651
SatI GCNGC 5 cut(s) 120, 123, 258, 371, 459
Sau3AI GATC 4 cut(s) 76, 397, 490, 729
Sau96I GGNCC 2 cut(s) 36, 643
SchI GAGTC 1 cut(s) 38
ScrFI CCNGG 3 cut(s) 16, 363, 695
SfaNI GCATC 3 cut(s) 430, 438, 606
SfcI CTRYAG 1 cut(s) 462
SinI GGWCC 2 cut(s) 36, 643
SmiMI CAYNNNNRTG 1 cut(s) 146
SmlI CTYRAG 1 cut(s) 497
SmoI CTYRAG 1 cut(s) 497
Sse9I AATT 6 cut(s) 7, 94, 108, 374, 648, 709
SspI AATATT 2 cut(s) 420, 514
SspMI CTAG 4 cut(s) 180, 221, 323, 582
StyD4I CCNGG 3 cut(s) 14, 361, 693
StyI CCWWGG 2 cut(s) 322, 528
TaaI ACNGT 2 cut(s) 36, 287
TaiI ACGT 1 cut(s) 188
TasI AATT 6 cut(s) 7, 94, 108, 374, 648, 709
TfiI GAWTC 2 cut(s) 200, 278
Tru1I TTAA 4 cut(s) 411, 498, 572, 651
Tru9I TTAA 4 cut(s) 411, 498, 572, 651
TseFI GTSAC 1 cut(s) 30
TseI GCWGC 5 cut(s) 119, 122, 257, 370, 458
Tsp45I GTSAC 1 cut(s) 30
TspDTI ATGAA 1 cut(s) 270
TspGWI ACGGA 1 cut(s) 397
Vha464I CTTAAG 1 cut(s) 497
VpaK11BI GGWCC 2 cut(s) 36, 643
VspI ATTAAT 2 cut(s) 572, 651
XapI RAATTY 2 cut(s) 7, 709
XceI RCATGY 2 cut(s) 257, 591
XmaJI CCTAGG 1 cut(s) 322
XspI CTAG 4 cut(s) 180, 221, 323, 582
Zsp2I ATGCAT 3 cut(s) 143, 436, 453
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.