Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022928.1

Orthogroup ID

OG0020218

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 1894

Gene Structure 1894 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022928.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 605 bp

atgacatttcaaagatctaaccttttgttgtgtgaacaatggatttctgtccagttctcccgtcgtgaatcaggagtaacccatgtcctagtaacgggaggtgctggatatattggttcacatgctgcattacgacttctaaaggattcataccgtgtaactattgtggataacctctcacggggaaacctaggtgcagtcaaggttctccaacaactatttcctgagcctgggaggctgcaatttatttatgctgacttgggggatccaaaatccgttaacaaaatattttcagagaatgcatttgatgctgtgatgcattttgcagctgtagcatatgtcggggaaagcacccttgatccacttaagtattaccacaatattacatcaaataccttggtagtagtagaggcaatggccaaacatcgtgtgaggacattaatatattctagcacatgtgcaacatatggagaaccggaaaagatgcctattactgaagaaactacacaggtcccaattaatccatatggaaaagctaagaagatggcagaggatattatcctggatttctctaagaattcaaacatggcagtcatgatcctgag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005794 GO:0005975 GO:0005996 GO:0007275 GO:0008150 GO:0008152 GO:0009058 GO:0009790 GO:0009791 GO:0009793 GO:0009832 GO:0009856 GO:0009987 GO:0010154 GO:0012505 GO:0016051 GO:0016853 GO:0016854 GO:0016857 GO:0019321 GO:0019322 GO:0019566 GO:0019567 GO:0022414 GO:0032501 GO:0032502 GO:0042546 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044085 GO:0044238 GO:0044281 GO:0044283 GO:0044424 GO:0044444 GO:0044464 GO:0044706 GO:0046364 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0048868 GO:0050373 GO:0051704 GO:0061458 GO:0071554 GO:0071669 GO:0071704 GO:0071840 GO:1901576

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

GDP_Man_Dehyd

Protein Analysis

201

Amino Acids

22.37

Weight (kDa)

7.77

Isoelectric Point (pI)

44.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020218)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G30620
pyrus_communis	pycom17g11960 pycom17g11970
rosa_multiflora	Rmu_sc0005702.1_g000001 Rmu_sc0022928.1_g000001
rosa_wichuraiana	Rw2G041570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	4 cut(s)	260, 273, 353, 592
AcoI	YGGCCR	1 cut(s)	417
AcsI	RAATTY	1 cut(s)	577
AcuI	CTGAAG	1 cut(s)	516
AfiI	CCNNNNNNNGG	3 cut(s)	94, 181, 230
AflII	CTTAAG	1 cut(s)	365
AflIII	ACRYGT	1 cut(s)	455
AgsI	TTSAA	2 cut(s)	11, 582
AjnI	CCWGG	2 cut(s)	229, 561
AjuI	GAANNNNNNNTTGG	2 cut(s)	204, 236
AluBI	AGCT	2 cut(s)	329, 536
AluI	AGCT	2 cut(s)	329, 536
AlwI	GGATC	4 cut(s)	260, 273, 353, 592
AoxI	GGCC	1 cut(s)	417
ApeKI	GCWGC	3 cut(s)	125, 238, 326
ApoI	RAATTY	1 cut(s)	577
AseI	ATTAAT	2 cut(s)	440, 519
AspA2I	CCTAGG	1 cut(s)	190
AspS9I	GGNCC	1 cut(s)	511
AvaII	GGWCC	1 cut(s)	511
AvrII	CCTAGG	1 cut(s)	190
BalI	TGGCCA	1 cut(s)	419
BamHI	GGATCC	1 cut(s)	265
BbvI	GCAGC	3 cut(s)	112, 225, 338
BccI	CCATC	1 cut(s)	538
BciT130I	CCWGG	2 cut(s)	231, 563
BfaI	CTAG	3 cut(s)	89, 191, 450
BfmI	CTRYAG	1 cut(s)	330
BfrI	CTTAAG	1 cut(s)	365
BglI	GCCNNNNNGGC	1 cut(s)	235
BglII	AGATCT	1 cut(s)	14
BisI	GCNGC	3 cut(s)	126, 239, 327
BlnI	CCTAGG	1 cut(s)	190
BlsI	GCNGC	3 cut(s)	127, 240, 328
Bme1390I	CCNGG	2 cut(s)	231, 563
Bme18I	GGWCC	1 cut(s)	511
BmgT120I	GGNCC	1 cut(s)	511
BmiI	GGNNCC	2 cut(s)	267, 513
BmrFI	CCNGG	2 cut(s)	231, 563
BmsI	GCATC	3 cut(s)	298, 306, 474
Bpu10I	CCTNAGC	1 cut(s)	225
BsaJI	CCNNGG	3 cut(s)	190, 230, 396
BsaWI	WCCGGW	1 cut(s)	475
Bsc4I	CCNNNNNNNGG	3 cut(s)	94, 181, 230
Bse1I	ACTGG	1 cut(s)	52
Bse3DI	GCAATG	1 cut(s)	420
BseBI	CCWGG	2 cut(s)	231, 563
BseDI	CCNNGG	3 cut(s)	190, 230, 396
BseLI	CCNNNNNNNGG	3 cut(s)	94, 181, 230
BseMI	GCAATG	1 cut(s)	420
BseMII	CTCAG	2 cut(s)	216, 593
BseNI	ACTGG	1 cut(s)	52
BseXI	GCAGC	3 cut(s)	112, 225, 338
BsgI	GTGCAG	1 cut(s)	216
BshFI	GGCC	1 cut(s)	419
BsiSI	CCGG	1 cut(s)	476
BslFI	GGGAC	1 cut(s)	497
BslI	CCNNNNNNNGG	3 cut(s)	94, 181, 230
BsmFI	GGGAC	1 cut(s)	497
BsmI	GAATGC	1 cut(s)	304
BsnI	GGCC	1 cut(s)	419
Bsp143I	GATC	4 cut(s)	14, 265, 358, 597
BspANI	GGCC	1 cut(s)	419
BspCNI	CTCAG	2 cut(s)	217, 594
BspHI	TCATGA	1 cut(s)	594
BspLI	GGNNCC	2 cut(s)	267, 513
BspPI	GGATC	4 cut(s)	260, 273, 353, 592
BspTI	CTTAAG	1 cut(s)	365
BsrDI	GCAATG	1 cut(s)	420
BsrI	ACTGG	1 cut(s)	52
BssECI	CCNNGG	3 cut(s)	190, 230, 396
BssMI	GATC	4 cut(s)	14, 265, 358, 597
BssT1I	CCWWGG	2 cut(s)	190, 396
Bst2UI	CCWGG	2 cut(s)	231, 563
Bst4CI	ACNGT	1 cut(s)	155
BstAFI	CTTAAG	1 cut(s)	365
BstAPI	GCANNNNNTGC	1 cut(s)	308
BstDEI	CTNAG	4 cut(s)	225, 537, 573, 602
BstKTI	GATC	4 cut(s)	17, 268, 361, 600
BstMBI	GATC	4 cut(s)	14, 265, 358, 597
BstMWI	GCNNNNNNNGC	3 cut(s)	235, 308, 332
BstNI	CCWGG	2 cut(s)	231, 563
BstNSI	RCATGY	2 cut(s)	125, 459
BstSCI	CCNGG	2 cut(s)	229, 561
BstSFI	CTRYAG	1 cut(s)	330
BstV1I	GCAGC	3 cut(s)	112, 225, 338
BstX2I	RGATCY	2 cut(s)	14, 265
BstYI	RGATCY	2 cut(s)	14, 265
BsuRI	GGCC	1 cut(s)	419
CciI	TCATGA	1 cut(s)	594
Cfr13I	GGNCC	1 cut(s)	511
CviAII	CATG	5 cut(s)	83, 122, 456, 586, 595
CviJI	RGCY	5 cut(s)	229, 238, 329, 419, 536
CviKI_1	RGCY	5 cut(s)	229, 238, 329, 419, 536
DdeI	CTNAG	4 cut(s)	225, 537, 573, 602
DpnI	GATC	4 cut(s)	16, 267, 360, 599
DpnII	GATC	4 cut(s)	14, 265, 358, 597
EaeI	YGGCCR	1 cut(s)	417
Eco130I	CCWWGG	2 cut(s)	190, 396
Eco47I	GGWCC	1 cut(s)	511
Eco57I	CTGAAG	1 cut(s)	516
EcoO109I	RGGNCCY	1 cut(s)	511
EcoRI	GAATTC	1 cut(s)	577
EcoRII	CCWGG	2 cut(s)	229, 561
EcoT14I	CCWWGG	2 cut(s)	190, 396
EcoT22I	ATGCAT	2 cut(s)	304, 321
ErhI	CCWWGG	2 cut(s)	190, 396
FaeI	CATG	5 cut(s)	86, 125, 459, 589, 598
FaqI	GGGAC	1 cut(s)	497
FatI	CATG	5 cut(s)	82, 121, 455, 585, 594
FauNDI	CATATG	3 cut(s)	337, 466, 526
Fnu4HI	GCNGC	3 cut(s)	126, 239, 327
Fsp4HI	GCNGC	3 cut(s)	126, 239, 327
FspBI	CTAG	3 cut(s)	89, 191, 450
GluI	GCNGC	3 cut(s)	126, 239, 327
HaeIII	GGCC	1 cut(s)	419
HapII	CCGG	1 cut(s)	476
Hin1II	CATG	5 cut(s)	86, 125, 459, 589, 598
HincII	GTYRAC	1 cut(s)	280
HindII	GTYRAC	1 cut(s)	280
HinfI	GANTC	2 cut(s)	68, 146
HpaI	GTTAAC	1 cut(s)	280
HpaII	CCGG	1 cut(s)	476
Hpy166II	GTNNAC	3 cut(s)	35, 119, 280
Hpy188I	TCNGA	1 cut(s)	295
Hpy188III	TCNNGA	5 cut(s)	65, 72, 224, 595, 601
Hpy8I	GTNNAC	3 cut(s)	35, 119, 280
Hpy99I	CGWCG	1 cut(s)	66
HpyCH4III	ACNGT	1 cut(s)	155
HpyCH4V	TGCA	7 cut(s)	128, 197, 241, 302, 319, 326, 461
HpyF10VI	GCNNNNNNNGC	3 cut(s)	235, 308, 332
HpyF3I	CTNAG	4 cut(s)	225, 537, 573, 602
Hsp92II	CATG	5 cut(s)	86, 125, 459, 589, 598
KspAI	GTTAAC	1 cut(s)	280
Kzo9I	GATC	4 cut(s)	14, 265, 358, 597
Lsp1109I	GCAGC	3 cut(s)	112, 225, 338
LweI	GCATC	3 cut(s)	298, 306, 474
MaeI	CTAG	3 cut(s)	89, 191, 450
MaeIII	GTNAC	3 cut(s)	76, 91, 157
MalI	GATC	4 cut(s)	16, 267, 360, 599
MboI	GATC	4 cut(s)	14, 265, 358, 597
MboII	GAAGA	2 cut(s)	509, 553
MflI	RGATCY	2 cut(s)	14, 265
MlsI	TGGCCA	1 cut(s)	419
MluCI	AATT	3 cut(s)	242, 516, 577
MluNI	TGGCCA	1 cut(s)	419
MmeI	TCCRAC	1 cut(s)	235
MnlI	CCTC	6 cut(s)	92, 185, 228, 403, 426, 544
Mox20I	TGGCCA	1 cut(s)	419
Mph1103I	ATGCAT	2 cut(s)	304, 321
MscI	TGGCCA	1 cut(s)	419
MseI	TTAA	4 cut(s)	279, 366, 440, 519
Msp20I	TGGCCA	1 cut(s)	419
MspA1I	CMGCKG	1 cut(s)	329
MspCI	CTTAAG	1 cut(s)	365
MspI	CCGG	1 cut(s)	476
MspR9I	CCNGG	2 cut(s)	231, 563
Mva1269I	GAATGC	1 cut(s)	304
MvaI	CCWGG	2 cut(s)	231, 563
MwoI	GCNNNNNNNGC	3 cut(s)	235, 308, 332
NdeI	CATATG	3 cut(s)	337, 466, 526
NdeII	GATC	4 cut(s)	14, 265, 358, 597
NlaIII	CATG	5 cut(s)	86, 125, 459, 589, 598
NlaIV	GGNNCC	2 cut(s)	267, 513
NsiI	ATGCAT	2 cut(s)	304, 321
NspI	RCATGY	2 cut(s)	125, 459
PagI	TCATGA	1 cut(s)	594
PciI	ACATGT	1 cut(s)	455
PctI	GAATGC	1 cut(s)	304
PfeI	GAWTC	2 cut(s)	68, 146
PfoI	TCCNGGA	1 cut(s)	561
PkrI	GCNGC	3 cut(s)	127, 240, 328
PpuMI	RGGWCCY	1 cut(s)	511
PscI	ACATGT	1 cut(s)	455
PshBI	ATTAAT	2 cut(s)	440, 519
Psp5II	RGGWCCY	1 cut(s)	511
Psp6I	CCWGG	2 cut(s)	229, 561
PspGI	CCWGG	2 cut(s)	229, 561
PspN4I	GGNNCC	2 cut(s)	267, 513
PspPI	GGNCC	1 cut(s)	511
PspPPI	RGGWCCY	1 cut(s)	511
PsuI	RGATCY	2 cut(s)	14, 265
PvuII	CAGCTG	1 cut(s)	329
SaqAI	TTAA	4 cut(s)	279, 366, 440, 519
SatI	GCNGC	3 cut(s)	126, 239, 327
Sau3AI	GATC	4 cut(s)	14, 265, 358, 597
Sau96I	GGNCC	1 cut(s)	511
ScrFI	CCNGG	2 cut(s)	231, 563
SfaNI	GCATC	3 cut(s)	298, 306, 474
SfcI	CTRYAG	1 cut(s)	330
SinI	GGWCC	1 cut(s)	511
SmlI	CTYRAG	1 cut(s)	365
SmoI	CTYRAG	1 cut(s)	365
Sse9I	AATT	3 cut(s)	242, 516, 577
SspI	AATATT	2 cut(s)	288, 382
SspMI	CTAG	3 cut(s)	89, 191, 450
StyD4I	CCNGG	2 cut(s)	229, 561
StyI	CCWWGG	2 cut(s)	190, 396
TaaI	ACNGT	1 cut(s)	155
TasI	AATT	3 cut(s)	242, 516, 577
TfiI	GAWTC	2 cut(s)	68, 146
Tru1I	TTAA	4 cut(s)	279, 366, 440, 519
Tru9I	TTAA	4 cut(s)	279, 366, 440, 519
TseI	GCWGC	3 cut(s)	125, 238, 326
TspDTI	ATGAA	1 cut(s)	138
TspGWI	ACGGA	1 cut(s)	265
Vha464I	CTTAAG	1 cut(s)	365
VpaK11BI	GGWCC	1 cut(s)	511
VspI	ATTAAT	2 cut(s)	440, 519
XapI	RAATTY	1 cut(s)	577
XceI	RCATGY	2 cut(s)	125, 459
XmaJI	CCTAGG	1 cut(s)	190
XspI	CTAG	3 cut(s)	89, 191, 450
Zsp2I	ATGCAT	2 cut(s)	304, 321

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.