Rmu_sc0006246.1_g000001
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006246.1
Physical Location & Seq
Forward (+)
1 .. 1179
1179 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006246.1_g000001.1.cds

Sequence Viewer

Length: 867 bp
gatgcatatgcgctctgccgaatttttaagaagactgcaactgggccaaagataggagagcattatggtagcacaagtagtactactaattatcaacttgccagtgaccaccattcgtctagcgttgagctatactctgattcaagaggtgatcaagattttgagagctcccgctacaataatcagatggcaatgaatactccatgctcttcaaacatggttcatacatcctcttcatcttcttttgatcatatgggtagaaagagagatggaaaatggacccagttcttatcgaaggacgcatttaatagcttttcctcatttcccaatcagggagccatttcttaccctacatctaaggttgatatagcattggagtgtgcaaggctgcagcatcggctcacacttcctccgttagaagtggaggattttcctcatgttgggtttaccgacttcaaaaccctgcaatattcagatcctggacttgagggcacaggtacagaaactgatgcgttgcaagaaattctctcagttgcgcatgtttctcaagagatgataaatcagtccagtaattttgcggatcaaacatggggttctgcaaactatgttccaggagccaatgatttcagctttatggttgacagagatgctcactataatcagattacaactcatcatgacatgaatcctatgagatatgtggacaagccgtgggaaaattcatatattagatcaattgaaattggagatttggaggatgatgatttcaggacagacaatacaacggagaatctgaggtggataggaatgtcagacaaagatttggagaaggtatcacaagtcatcaaacttaatctgcatgcatga

Protein Analysis

288

Amino Acids

32.52

Weight (kDa)

4.99

Isoelectric Point (pI)

33.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 537
AciI CCGC 2 cut(s) 172, 578
AclWI GGATC 2 cut(s) 470, 588
AcsI RAATTY 3 cut(s) 21, 522, 718
AfaI GTAC 2 cut(s) 82, 499
AfiI CCNNNNNNNGG 3 cut(s) 53, 332, 440
AgsI TTSAA 4 cut(s) 144, 213, 457, 740
AjnI CCWGG 2 cut(s) 478, 610
AluBI AGCT 4 cut(s) 130, 168, 312, 630
AluI AGCT 4 cut(s) 130, 168, 312, 630
Alw21I GWGCWC 1 cut(s) 170
AlwI GGATC 2 cut(s) 470, 588
AlwNI CAGNNNCTG 2 cut(s) 479, 506
AoxI GGCC 1 cut(s) 44
ApeKI GCWGC 2 cut(s) 388, 391
ApoI RAATTY 3 cut(s) 21, 522, 718
AspLEI GCGC 2 cut(s) 13, 538
AspS9I GGNCC 2 cut(s) 44, 279
AsuHPI GGTGA 1 cut(s) 161
AvaII GGWCC 1 cut(s) 279
BaeGI GKGCMC 1 cut(s) 494
BanII GRGCYC 1 cut(s) 170
BbsI GAAGAC 1 cut(s) 38
Bbv12I GWGCWC 1 cut(s) 170
BbvI GCAGC 2 cut(s) 375, 403
BccI CCATC 2 cut(s) 181, 263
BceAI ACGGC 1 cut(s) 694
BciT130I CCWGG 2 cut(s) 480, 612
BclI TGATCA 2 cut(s) 151, 247
BfaI CTAG 1 cut(s) 120
BfmI CTRYAG 1 cut(s) 389
BisI GCNGC 2 cut(s) 389, 392
BlsI GCNGC 2 cut(s) 390, 393
BmcAI AGTACT 1 cut(s) 82
Bme1390I CCNGG 2 cut(s) 480, 612
Bme18I GGWCC 1 cut(s) 279
BmgT120I GGNCC 2 cut(s) 44, 279
BmiI GGNNCC 3 cut(s) 281, 337, 616
BmrFI CCNGG 2 cut(s) 480, 612
BmrI ACTGGG 2 cut(s) 51, 277
BmsI GCATC 3 cut(s) 403, 499, 637
BmuI ACTGGG 2 cut(s) 51, 277
BpiI GAAGAC 1 cut(s) 38
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BpuEI CTTGAG 2 cut(s) 506, 531
BsaJI CCNNGG 1 cut(s) 710
BsaXI ACNNNNNCTCC 2 cut(s) 394, 424
Bsc4I CCNNNNNNNGG 3 cut(s) 53, 332, 440
Bse1I ACTGG 4 cut(s) 46, 102, 283, 567
Bse3DI GCAATG 1 cut(s) 198
BseBI CCWGG 2 cut(s) 480, 612
BseDI CCNNGG 1 cut(s) 710
BseGI GGATG 2 cut(s) 227, 763
BseLI CCNNNNNNNGG 3 cut(s) 53, 332, 440
BseMI GCAATG 1 cut(s) 198
BseMII CTCAG 2 cut(s) 543, 785
BseNI ACTGG 4 cut(s) 46, 102, 283, 567
BseSI GKGCMC 1 cut(s) 494
BseXI GCAGC 2 cut(s) 375, 403
BshFI GGCC 1 cut(s) 46
BsiHKAI GWGCWC 1 cut(s) 170
BslI CCNNNNNNNGG 3 cut(s) 53, 332, 440
BsnI GGCC 1 cut(s) 46
Bsp1286I GDGCHC 2 cut(s) 170, 494
Bsp143I GATC 5 cut(s) 151, 247, 475, 580, 731
BspACI CCGC 2 cut(s) 172, 578
BspANI GGCC 1 cut(s) 46
BspCNI CTCAG 2 cut(s) 542, 786
BspHI TCATGA 1 cut(s) 676
BspLI GGNNCC 3 cut(s) 281, 337, 616
BspMAI CTGCAG 1 cut(s) 393
BspPI GGATC 2 cut(s) 470, 588
BspQI GCTCTTC 1 cut(s) 214
BsrDI GCAATG 1 cut(s) 198
BsrI ACTGG 4 cut(s) 46, 102, 283, 567
BssECI CCNNGG 1 cut(s) 710
BssMI GATC 5 cut(s) 151, 247, 475, 580, 731
Bst2UI CCWGG 2 cut(s) 480, 612
Bst6I CTCTTC 2 cut(s) 214, 238
BstC8I GCNNGC 1 cut(s) 861
BstDEI CTNAG 3 cut(s) 357, 529, 794
BstDSI CCRYGG 1 cut(s) 710
BstF5I GGATG 2 cut(s) 227, 763
BstHHI GCGC 2 cut(s) 13, 538
BstKTI GATC 5 cut(s) 154, 250, 478, 583, 734
BstMBI GATC 5 cut(s) 151, 247, 475, 580, 731
BstMWI GCNNNNNNNGC 1 cut(s) 397
BstNI CCWGG 2 cut(s) 480, 612
BstNSI RCATGY 2 cut(s) 542, 863
BstSCI CCNGG 2 cut(s) 478, 610
BstSFI CTRYAG 1 cut(s) 389
BstSLI GKGCMC 1 cut(s) 494
BstV1I GCAGC 2 cut(s) 375, 403
BstV2I GAAGAC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 475
BstYI RGATCY 1 cut(s) 475
BsuRI GGCC 1 cut(s) 46
BtgI CCRYGG 1 cut(s) 710
BtsCI GGATG 2 cut(s) 227, 763
BtsIMutI CAGTG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 861
CaiI CAGNNNCTG 2 cut(s) 479, 506
CciI TCATGA 1 cut(s) 676
CfoI GCGC 2 cut(s) 13, 538
Cfr13I GGNCC 2 cut(s) 44, 279
CseI GACGC 1 cut(s) 308
Csp6I GTAC 2 cut(s) 81, 498
CviAII CATG 9 cut(s) 204, 217, 437, 539, 588, 677, 682, 860, 864
CviQI GTAC 2 cut(s) 81, 498
DdeI CTNAG 3 cut(s) 357, 529, 794
DpnI GATC 5 cut(s) 153, 249, 477, 582, 733
DpnII GATC 5 cut(s) 151, 247, 475, 580, 731
Eam1104I CTCTTC 2 cut(s) 214, 238
EarI CTCTTC 2 cut(s) 214, 238
Ecl136II GAGCTC 1 cut(s) 168
Eco24I GRGCYC 1 cut(s) 170
Eco47I GGWCC 1 cut(s) 279
Eco53kI GAGCTC 1 cut(s) 168
EcoICRI GAGCTC 1 cut(s) 168
EcoRII CCWGG 2 cut(s) 478, 610
EcoT22I ATGCAT 2 cut(s) 7, 865
EcoT38I GRGCYC 1 cut(s) 170
FaeI CATG 9 cut(s) 207, 220, 440, 542, 591, 680, 685, 863, 867
FatI CATG 9 cut(s) 203, 216, 436, 538, 587, 676, 681, 859, 863
FauI CCCGC 1 cut(s) 179
FauNDI CATATG 2 cut(s) 7, 252
FbaI TGATCA 2 cut(s) 151, 247
Fnu4HI GCNGC 2 cut(s) 389, 392
FokI GGATG 2 cut(s) 214, 770
FriOI GRGCYC 1 cut(s) 170
Fsp4HI GCNGC 2 cut(s) 389, 392
FspBI CTAG 1 cut(s) 120
FspI TGCGCA 1 cut(s) 537
GlaI GCGC 2 cut(s) 12, 537
GluI GCNGC 2 cut(s) 389, 392
HaeIII GGCC 1 cut(s) 46
HgaI GACGC 1 cut(s) 308
HhaI GCGC 2 cut(s) 13, 538
Hin1II CATG 9 cut(s) 207, 220, 440, 542, 591, 680, 685, 863, 867
Hin6I GCGC 2 cut(s) 11, 536
HinP1I GCGC 2 cut(s) 11, 536
HincII GTYRAC 1 cut(s) 640
HindII GTYRAC 1 cut(s) 640
HinfI GANTC 3 cut(s) 140, 685, 790
HphI GGTGA 1 cut(s) 161
Hpy166II GTNNAC 3 cut(s) 447, 640, 703
Hpy188I TCNGA 6 cut(s) 139, 186, 475, 663, 795, 814
Hpy188III TCNNGA 5 cut(s) 144, 155, 548, 677, 769
Hpy8I GTNNAC 3 cut(s) 447, 640, 703
HpyAV CCTTC 2 cut(s) 289, 823
HpyCH4V TGCA 9 cut(s) 5, 38, 383, 391, 466, 517, 599, 859, 863
HpyF10VI GCNNNNNNNGC 1 cut(s) 397
HpyF3I CTNAG 3 cut(s) 357, 529, 794
Hsp92II CATG 9 cut(s) 207, 220, 440, 542, 591, 680, 685, 863, 867
HspAI GCGC 2 cut(s) 11, 536
Ksp22I TGATCA 2 cut(s) 151, 247
Kzo9I GATC 5 cut(s) 151, 247, 475, 580, 731
LguI GCTCTTC 1 cut(s) 214
LmnI GCTCC 3 cut(s) 173, 335, 614
Lsp1109I GCAGC 2 cut(s) 375, 403
LweI GCATC 3 cut(s) 403, 499, 637
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 104
MalI GATC 5 cut(s) 153, 249, 477, 582, 733
MboI GATC 5 cut(s) 151, 247, 475, 580, 731
MboII GAAGA 4 cut(s) 43, 201, 225, 231
MfeI CAATTG 1 cut(s) 735
MflI RGATCY 1 cut(s) 475
MhlI GDGCHC 2 cut(s) 170, 494
MluCI AATT 7 cut(s) 21, 88, 522, 571, 718, 735, 741
MnlI CCTC 9 cut(s) 140, 241, 328, 418, 420, 444, 481, 748, 789
Mph1103I ATGCAT 2 cut(s) 7, 865
MseI TTAA 3 cut(s) 27, 306, 852
MslI CAYNNNNRTG 1 cut(s) 376
MspR9I CCNGG 2 cut(s) 480, 612
MunI CAATTG 1 cut(s) 735
MvaI CCWGG 2 cut(s) 480, 612
MwoI GCNNNNNNNGC 1 cut(s) 397
NdeI CATATG 2 cut(s) 7, 252
NdeII GATC 5 cut(s) 151, 247, 475, 580, 731
NlaIII CATG 9 cut(s) 207, 220, 440, 542, 591, 680, 685, 863, 867
NlaIV GGNNCC 3 cut(s) 281, 337, 616
NmuCI GTSAC 1 cut(s) 104
NsbI TGCGCA 1 cut(s) 537
NsiI ATGCAT 2 cut(s) 7, 865
NspI RCATGY 2 cut(s) 542, 863
PaeI GCATGC 1 cut(s) 863
PagI TCATGA 1 cut(s) 676
PciSI GCTCTTC 1 cut(s) 214
PfeI GAWTC 3 cut(s) 140, 685, 790
PfoI TCCNGGA 2 cut(s) 478, 610
PkrI GCNGC 2 cut(s) 390, 393
Psp124BI GAGCTC 1 cut(s) 170
Psp6I CCWGG 2 cut(s) 478, 610
PspGI CCWGG 2 cut(s) 478, 610
PspN4I GGNNCC 3 cut(s) 281, 337, 616
PspPI GGNCC 2 cut(s) 44, 279
PstI CTGCAG 1 cut(s) 393
PstNI CAGNNNCTG 2 cut(s) 479, 506
PsuI RGATCY 1 cut(s) 475
RsaI GTAC 2 cut(s) 82, 499
RsaNI GTAC 2 cut(s) 81, 498
RseI CAYNNNNRTG 1 cut(s) 376
SacI GAGCTC 1 cut(s) 170
SapI GCTCTTC 1 cut(s) 214
SaqAI TTAA 3 cut(s) 27, 306, 852
SatI GCNGC 2 cut(s) 389, 392
Sau3AI GATC 5 cut(s) 151, 247, 475, 580, 731
Sau96I GGNCC 2 cut(s) 44, 279
ScaI AGTACT 1 cut(s) 82
ScrFI CCNGG 2 cut(s) 480, 612
SduI GDGCHC 2 cut(s) 170, 494
SetI ASST 9 cut(s) 132, 151, 170, 314, 363, 499, 632, 800, 834
SfaNI GCATC 3 cut(s) 403, 499, 637
SfcI CTRYAG 1 cut(s) 389
SinI GGWCC 1 cut(s) 279
SmiMI CAYNNNNRTG 1 cut(s) 376
SmlI CTYRAG 2 cut(s) 485, 546
SmoI CTYRAG 2 cut(s) 485, 546
SphI GCATGC 1 cut(s) 863
Sse9I AATT 7 cut(s) 21, 88, 522, 571, 718, 735, 741
SsiI CCGC 2 cut(s) 172, 578
SspI AATATT 1 cut(s) 470
SspMI CTAG 1 cut(s) 120
SstI GAGCTC 1 cut(s) 170
StyD4I CCNGG 2 cut(s) 478, 610
TaqI TCGA 1 cut(s) 293
TasI AATT 7 cut(s) 21, 88, 522, 571, 718, 735, 741
TatI WGTACW 1 cut(s) 80
TfiI GAWTC 3 cut(s) 140, 685, 790
Tru1I TTAA 3 cut(s) 27, 306, 852
Tru9I TTAA 3 cut(s) 27, 306, 852
TscAI CASTG 1 cut(s) 109
TseFI GTSAC 1 cut(s) 104
TseI GCWGC 2 cut(s) 388, 391
Tsp45I GTSAC 1 cut(s) 104
TspDTI ATGAA 5 cut(s) 209, 212, 225, 698, 711
TspGWI ACGGA 2 cut(s) 402, 800
TspRI CASTG 1 cut(s) 109
VpaK11BI GGWCC 1 cut(s) 279
XapI RAATTY 3 cut(s) 21, 522, 718
XceI RCATGY 2 cut(s) 542, 863
XspI CTAG 1 cut(s) 120
ZrmI AGTACT 1 cut(s) 82
Zsp2I ATGCAT 2 cut(s) 7, 865
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.