Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006572.1

Orthogroup ID

OG0010675

Physical Location & Seq

Genomic Coordinates Reverse (-)

1843 .. 3450

Gene Structure 1608 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006572.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1305 bp

atgaagcccatgacaagacaggagtatgttgcatctttgaggagaaagagtagcggattttctcggggtgcatccatttatcgtggggtgacaaggcaccaccagcatgggagatggcaagcaaggattgggagagtcgcagggaacaaagatttgtacctaggaactttcagcacccaagaggaagcagccgaggcatatgacattgctgccataaagttccgaggacttaatgcagtaaccaactttgacatgagcagatatgatgtcaagtccattctggagagcagcgcattgcccatcactactggtgccactgcaaagcgattgaaagacgttcagcagcagcagccgcctcctcctgcagatcatcatcatcagatcatgttgtcgtctgtgctggatcatcacggacaggttatcagatcctcatcatcaacagaacatgacatcatgagcaatgtgtactcagcatatggatcttatggagcccagcaggggtgcagttggccaactcttgcattcaaccaagcccaagctcaagcagctgctgctcctcatcaagcgccttttgccgctggcatcaatggcatgcagttgcactactcgccgtatggatatggatatggtaatgcacatgcacagagggtttggtgcaagcaagagcaagatactaattcaaatcaggaaaggagctttcatcatcaggatgatgatcatcttcgtcaacaactccagttgggaggtacccacaatttctttcatgaccatgatcagcagcagcagcagcagactagtggccttatgggactaatggattcttcagcagcatctatggaacacagctcaggttcaaattctgtcatatatagtggtggagatcaccatggtaataataatgggtatggaagcagtactacagggactggtggtggctatataatgcccatggttatgagtacagttgtagccaatgatgaccaaaatcaagctgatggaaataataacaatatcaatggttttggagatggtgatgatcaggaggccaatattaaggcgcagcagcttggttatgatcatcatcctcaaaatatgtttcttggttcaagtagtactatagatcccgcatatcagcatcacgcaagcaacaggaacttgtattatcatcttccagtacaggatgatcagcatgaatcgtcgtcagtggcagttgctactagtagtactacatgtaacatgaattgggtaccaacagctgttccaactcttgctcatcctacttttacagtctggaacgacacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

434

Amino Acids

47.64

Weight (kDa)

6.13

Isoelectric Point (pI)

44.05

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010675)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17430 AT5G17430
fragaria_vesca	FvH4_6g00160 FvH4_6g00160
malus_domestica	MD04G1247700.v1.1
prunus_persica	Prupe.6G364100_v2.0.a1
pyrus_communis	pycom12g24110
rosa_chinensis	RchiOBHm_Chr3g0447531
rosa_laevigata	RLG00000025991
rosa_multiflora	Rmu_co8415981.1_g000001 Rmu_sc0003550.1_g000011 Rmu_sc0006572.1_g000001 Rmu_sc0037294.1_g000005
rosa_roxburghii	Rroxscaffold_6G00425750
rosa_rugosa	Rorug02G0602600
rosa_samantha	Rh3AG002900 Rh3BG002400 Rh3CG002700 Rh3DG002800
rosa_wichuraiana	Rw3G000180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	2 cut(s)	746, 1246
AccB1I	GGYRCC	4 cut(s)	96, 311, 746, 1246
AciI	CCGC	4 cut(s)	54, 353, 576, 1125
AclWI	GGATC	4 cut(s)	411, 420, 487, 1115
AcoI	YGGCCR	1 cut(s)	509
AcsI	RAATTY	1 cut(s)	856
AcuI	CTGAAG	1 cut(s)	807
AfaI	GTAC	9 cut(s)	158, 467, 748, 916, 961, 1114, 1176, 1225, 1248
AfiI	CCNNNNNNNGG	1 cut(s)	498
AflIII	ACRYGT	1 cut(s)	1229
AgsI	TTSAA	5 cut(s)	331, 526, 681, 855, 1107
AhlI	ACTAGT	2 cut(s)	794, 1217
AluBI	AGCT	7 cut(s)	539, 548, 696, 846, 992, 1066, 1256
AluI	AGCT	7 cut(s)	539, 548, 696, 846, 992, 1066, 1256
AlwI	GGATC	4 cut(s)	411, 420, 487, 1115
AlwNI	CAGNNNCTG	2 cut(s)	551, 926
Ama87I	CYCGRG	1 cut(s)	63
AoxI	GGCC	3 cut(s)	509, 799, 1044
ApoI	RAATTY	1 cut(s)	856
Asp718I	GGTACC	2 cut(s)	746, 1246
AspA2I	CCTAGG	1 cut(s)	160
AspLEI	GCGC	3 cut(s)	293, 568, 1060
AsuHPI	GGTGA	3 cut(s)	100, 875, 1043
AvaI	CYCGRG	1 cut(s)	63
AvrII	CCTAGG	1 cut(s)	160
BalI	TGGCCA	1 cut(s)	511
BanI	GGYRCC	4 cut(s)	96, 311, 746, 1246
BanII	GRGCYC	1 cut(s)	493
BarI	GAAGNNNNNNTAC	2 cut(s)	901, 933
BccI	CCATC	4 cut(s)	108, 308, 989, 1022
BceAI	ACGGC	1 cut(s)	595
BclI	TGATCA	5 cut(s)	715, 772, 1036, 1075, 1183
BcuI	ACTAGT	2 cut(s)	794, 1217
BfaI	CTAG	3 cut(s)	161, 795, 1218
BfmI	CTRYAG	3 cut(s)	363, 918, 1116
BfoI	RGCGCY	1 cut(s)	569
BlnI	CCTAGG	1 cut(s)	160
BmcAI	AGTACT	3 cut(s)	916, 1114, 1225
BmeT110I	CYCGRG	1 cut(s)	63
BmiI	GGNNCC	5 cut(s)	98, 313, 490, 748, 1248
BmsI	GCATC	5 cut(s)	41, 80, 591, 839, 1144
BpmI	CTGGAG	2 cut(s)	302, 719
Bpu10I	CCTNAGC	1 cut(s)	847
BpuEI	CTTGAG	1 cut(s)	525
BsaBI	GATNNNNATC	5 cut(s)	372, 430, 714, 717, 1080
BsaJI	CCNNGG	5 cut(s)	160, 192, 223, 886, 948
BsaXI	ACNNNNNCTCC	2 cut(s)	34, 64
Bsc4I	CCNNNNNNNGG	1 cut(s)	498
Bse1I	ACTGG	4 cut(s)	313, 736, 931, 1172
Bse3DI	GCAATG	3 cut(s)	204, 293, 466
Bse8I	GATNNNNATC	5 cut(s)	372, 430, 714, 717, 1080
BseDI	CCNNGG	5 cut(s)	160, 192, 223, 886, 948
BseGI	GGATG	5 cut(s)	71, 715, 1081, 1186, 1273
BseJI	GATNNNNATC	5 cut(s)	372, 430, 714, 717, 1080
BseLI	CCNNNNNNNGG	1 cut(s)	498
BseMI	GCAATG	3 cut(s)	204, 293, 466
BseMII	CTCAG	2 cut(s)	483, 861
BseNI	ACTGG	4 cut(s)	313, 736, 931, 1172
BseRI	GAGGAG	3 cut(s)	55, 348, 546
BseYI	CCCAGC	1 cut(s)	492
BsgI	GTGCAG	1 cut(s)	523
BshFI	GGCC	3 cut(s)	511, 801, 1046
BshNI	GGYRCC	4 cut(s)	96, 311, 746, 1246
BsiHKCI	CYCGRG	1 cut(s)	63
BslFI	GGGAC	2 cut(s)	822, 937
BslI	CCNNNNNNNGG	1 cut(s)	498
BsmFI	GGGAC	2 cut(s)	822, 937
BsmI	GAATGC	1 cut(s)	521
BsnI	GGCC	3 cut(s)	511, 801, 1046
BsoBI	CYCGRG	1 cut(s)	63
Bsp1286I	GDGCHC	1 cut(s)	493
Bsp19I	CCATGG	2 cut(s)	886, 948
BspACI	CCGC	4 cut(s)	54, 353, 576, 1125
BspANI	GGCC	3 cut(s)	511, 801, 1046
BspCNI	CTCAG	2 cut(s)	482, 860
BspHI	TCATGA	2 cut(s)	453, 763
BspLI	GGNNCC	5 cut(s)	98, 313, 490, 748, 1248
BspMAI	CTGCAG	1 cut(s)	367
BspPI	GGATC	4 cut(s)	411, 420, 487, 1115
BspT107I	GGYRCC	4 cut(s)	96, 311, 746, 1246
BsrDI	GCAATG	3 cut(s)	204, 293, 466
BsrI	ACTGG	4 cut(s)	313, 736, 931, 1172
BssECI	CCNNGG	5 cut(s)	160, 192, 223, 886, 948
BssT1I	CCWWGG	3 cut(s)	160, 886, 948
Bst4CI	ACNGT	2 cut(s)	964, 1288
BstAPI	GCANNNNNTGC	1 cut(s)	551
BstC8I	GCNNGC	5 cut(s)	120, 580, 593, 659, 1144
BstDEI	CTNAG	2 cut(s)	469, 847
BstDSI	CCRYGG	2 cut(s)	886, 948
BstF5I	GGATG	5 cut(s)	71, 715, 1081, 1186, 1273
BstH2I	RGCGCY	1 cut(s)	569
BstHHI	GCGC	3 cut(s)	293, 568, 1060
BstNSI	RCATGY	3 cut(s)	595, 641, 1233
BstSFI	CTRYAG	3 cut(s)	363, 918, 1116
BstX2I	RGATCY	3 cut(s)	425, 479, 1120
BstXI	CCANNNNNNTGG	1 cut(s)	107
BstYI	RGATCY	3 cut(s)	425, 479, 1120
BsuRI	GGCC	3 cut(s)	511, 801, 1046
BtgI	CCRYGG	2 cut(s)	886, 948
BtsCI	GGATG	5 cut(s)	71, 715, 1081, 1186, 1273
BtsI	GCAGTG	1 cut(s)	315
BtsIMutI	CAGTG	2 cut(s)	315, 1209
Cac8I	GCNNGC	5 cut(s)	120, 580, 593, 659, 1144
CaiI	CAGNNNCTG	2 cut(s)	551, 926
CciI	TCATGA	2 cut(s)	453, 763
CfoI	GCGC	3 cut(s)	293, 568, 1060
Csp6I	GTAC	9 cut(s)	157, 466, 747, 915, 960, 1113, 1175, 1224, 1247
CviQI	GTAC	9 cut(s)	157, 466, 747, 915, 960, 1113, 1175, 1224, 1247
DdeI	CTNAG	2 cut(s)	469, 847
EaeI	YGGCCR	1 cut(s)	509
Eco130I	CCWWGG	3 cut(s)	160, 886, 948
Eco24I	GRGCYC	1 cut(s)	493
Eco57I	CTGAAG	1 cut(s)	807
Eco88I	CYCGRG	1 cut(s)	63
EcoT14I	CCWWGG	3 cut(s)	160, 886, 948
EcoT38I	GRGCYC	1 cut(s)	493
ErhI	CCWWGG	3 cut(s)	160, 886, 948
FaqI	GGGAC	2 cut(s)	822, 937
FauI	CCCGC	1 cut(s)	1132
FauNDI	CATATG	2 cut(s)	199, 475
FbaI	TGATCA	5 cut(s)	715, 772, 1036, 1075, 1183
FokI	GGATG	5 cut(s)	58, 722, 1068, 1193, 1260
FriOI	GRGCYC	1 cut(s)	493
FspBI	CTAG	3 cut(s)	161, 795, 1218
GlaI	GCGC	3 cut(s)	292, 567, 1059
GsaI	CCCAGC	1 cut(s)	496
GsuI	CTGGAG	2 cut(s)	302, 719
HaeII	RGCGCY	1 cut(s)	569
HaeIII	GGCC	3 cut(s)	511, 801, 1046
HhaI	GCGC	3 cut(s)	293, 568, 1060
Hin6I	GCGC	3 cut(s)	291, 566, 1058
HinP1I	GCGC	3 cut(s)	291, 566, 1058
HincII	GTYRAC	1 cut(s)	728
HindII	GTYRAC	1 cut(s)	728
HinfI	GANTC	3 cut(s)	135, 818, 1193
HphI	GGTGA	3 cut(s)	100, 875, 1043
Hpy166II	GTNNAC	2 cut(s)	466, 728
Hpy188I	TCNGA	3 cut(s)	224, 381, 425
Hpy188III	TCNNGA	7 cut(s)	281, 454, 686, 707, 764, 1040, 1291
Hpy8I	GTNNAC	2 cut(s)	466, 728
Hpy99I	CGWCG	1 cut(s)	1201
HpyCH4III	ACNGT	2 cut(s)	964, 1288
HpyCH4IV	ACGT	1 cut(s)	336
HpyF3I	CTNAG	2 cut(s)	469, 847
HpySE526I	ACGT	1 cut(s)	336
HspAI	GCGC	3 cut(s)	291, 566, 1058
KpnI	GGTACC	2 cut(s)	750, 1250
Ksp22I	TGATCA	5 cut(s)	715, 772, 1036, 1075, 1183
LmnI	GCTCC	3 cut(s)	488, 559, 693
LweI	GCATC	5 cut(s)	41, 80, 591, 839, 1144
MaeI	CTAG	3 cut(s)	161, 795, 1218
MaeII	ACGT	1 cut(s)	336
MaeIII	GTNAC	3 cut(s)	88, 238, 1232
MboII	GAAGA	3 cut(s)	713, 813, 1160
MflI	RGATCY	3 cut(s)	425, 479, 1120
MhlI	GDGCHC	1 cut(s)	493
MlsI	TGGCCA	1 cut(s)	511
MluCI	AATT	4 cut(s)	676, 754, 856, 1240
MluNI	TGGCCA	1 cut(s)	511
MlyI	GAGTC	1 cut(s)	144
MmeI	TCCRAC	1 cut(s)	1286
Mox20I	TGGCCA	1 cut(s)	511
MscI	TGGCCA	1 cut(s)	511
MseI	TTAA	2 cut(s)	231, 1053
MslI	CAYNNNNRTG	4 cut(s)	105, 708, 768, 953
Msp20I	TGGCCA	1 cut(s)	511
MspA1I	CMGCKG	3 cut(s)	548, 578, 1256
Mva1269I	GAATGC	1 cut(s)	521
NcoI	CCATGG	2 cut(s)	886, 948
NdeI	CATATG	2 cut(s)	199, 475
NlaIV	GGNNCC	5 cut(s)	98, 313, 490, 748, 1248
NmeAIII	GCCGAG	1 cut(s)	217
NmuCI	GTSAC	1 cut(s)	88
NspI	RCATGY	3 cut(s)	595, 641, 1233
PaeI	GCATGC	1 cut(s)	595
PagI	TCATGA	2 cut(s)	453, 763
PciI	ACATGT	1 cut(s)	1229
PctI	GAATGC	1 cut(s)	521
PfeI	GAWTC	2 cut(s)	818, 1193
PleI	GAGTC	1 cut(s)	143
PpsI	GAGTC	1 cut(s)	143
PscI	ACATGT	1 cut(s)	1229
PspFI	CCCAGC	1 cut(s)	492
PspN4I	GGNNCC	5 cut(s)	98, 313, 490, 748, 1248
PstI	CTGCAG	1 cut(s)	367
PstNI	CAGNNNCTG	2 cut(s)	551, 926
PsuI	RGATCY	3 cut(s)	425, 479, 1120
PvuII	CAGCTG	2 cut(s)	548, 1256
RsaI	GTAC	9 cut(s)	158, 467, 748, 916, 961, 1114, 1176, 1225, 1248
RsaNI	GTAC	9 cut(s)	157, 466, 747, 915, 960, 1113, 1175, 1224, 1247
RseI	CAYNNNNRTG	4 cut(s)	105, 708, 768, 953
SaqAI	TTAA	2 cut(s)	231, 1053
ScaI	AGTACT	3 cut(s)	916, 1114, 1225
SchI	GAGTC	1 cut(s)	144
SduI	GDGCHC	1 cut(s)	493
SfaNI	GCATC	5 cut(s)	41, 80, 591, 839, 1144
SfcI	CTRYAG	3 cut(s)	363, 918, 1116
SmiMI	CAYNNNNRTG	4 cut(s)	105, 708, 768, 953
SmlI	CTYRAG	1 cut(s)	540
SmoI	CTYRAG	1 cut(s)	540
SpeI	ACTAGT	2 cut(s)	794, 1217
SphI	GCATGC	1 cut(s)	595
Sse9I	AATT	4 cut(s)	676, 754, 856, 1240
SsiI	CCGC	4 cut(s)	54, 353, 576, 1125
SspI	AATATT	1 cut(s)	1051
SspMI	CTAG	3 cut(s)	161, 795, 1218
StyI	CCWWGG	3 cut(s)	160, 886, 948
TaaI	ACNGT	2 cut(s)	964, 1288
TaiI	ACGT	1 cut(s)	339
TasI	AATT	4 cut(s)	676, 754, 856, 1240
TatI	WGTACW	6 cut(s)	465, 914, 959, 1112, 1174, 1223
TauI	GCSGC	2 cut(s)	355, 578
TfiI	GAWTC	2 cut(s)	818, 1193
Tru1I	TTAA	2 cut(s)	231, 1053
Tru9I	TTAA	2 cut(s)	231, 1053
TscAI	CASTG	2 cut(s)	322, 1209
TseFI	GTSAC	1 cut(s)	88
Tsp45I	GTSAC	1 cut(s)	88
TspDTI	ATGAA	5 cut(s)	17, 689, 752, 1206, 1253
TspGWI	ACGGA	1 cut(s)	426
TspRI	CASTG	2 cut(s)	322, 1209
XapI	RAATTY	1 cut(s)	856
XceI	RCATGY	3 cut(s)	595, 641, 1233
XmaJI	CCTAGG	1 cut(s)	160
XspI	CTAG	3 cut(s)	161, 795, 1218
ZrmI	AGTACT	3 cut(s)	916, 1114, 1225

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.