Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037294.1

Orthogroup ID

OG0010675

Physical Location & Seq

Genomic Coordinates Reverse (-)

28304 .. 29891

Gene Structure 1588 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037294.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1245 bp

atgacaagacaggagtatgttgcatctttgaggaggcaccaccagcatgggagatggcaagcaaggattgggagagtcgcagggaacaaagatttgtacctaggaactttcagcacccaagaggaagcagccgaggcatatgacattgctgccataaagttccgaggacttaatgcagtaaccaactttgacatgagcagatatgatgtcaagtccattctggagagcagcgcattgcccatcactactggtgccactgcaaagcgattgaaagacgttcagcagcagcagccgcctcctcctgcagatcatcatcatcagatcatgttgtcgtctgtgctggatcatcacggacaggttatcagatcctcatcatcaacagaacatgacatcatgagcaatgtgtactcagcatatggatcttatggagcccagcaggggtgcagttggccaactcttgcattcaaccaagcccaagctcaagcagctgctgctcctcatcaagcgccttttgccgctggcatcaatggcatgcagttgcactactcgccgtatggatatggatatggtaatgcacatgcacagagggtttggtgcaagcaagagcaagatactaattcaaatcaggaaaggagctttcatcatcaggatgatgatcatcttcgtcaacaactccagttgggaggtacccacaatttctttcatgaccatgatcagcagcagcagcagcagactagtggccttatgggactaatggattcttcagcagcatctatggaacacagctcaggttcaaattctgtcatatatagtggtggagatcaccatggtaataataatgggtatggaagcagtactacagggactggtggtggctatataatgcccatggttatgagtacagttgtagccaatgatgaccaaaatcaagctgatggaaataataacaatatcaatggttttggagatggtgatgatcaggaggccaatattaaggcgcagcagcttggttatgatcatcatcctcaaaatatgtttcttggttcaagtagtactatagatcccgcttatcagcatcacgcaagcaacaggaacttgtattatcatcttccagtacaggatgatcagcatgaatcgtcgtcagtggcagttgctactagtagtactacatgtaacatgaattgggtaccaacagctgttccaactcttgctcatcctacttttacagtctggaacgacacatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003700 GO:0006355 GO:0008150 GO:0009889 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0031323 GO:0031326 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0140110 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

414

Amino Acids

45.47

Weight (kDa)

5.84

Isoelectric Point (pI)

46.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010675)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G17430 AT5G17430
fragaria_vesca	FvH4_6g00160 FvH4_6g00160
malus_domestica	MD04G1247700.v1.1
prunus_persica	Prupe.6G364100_v2.0.a1
pyrus_communis	pycom12g24110
rosa_chinensis	RchiOBHm_Chr3g0447531
rosa_laevigata	RLG00000025991
rosa_multiflora	Rmu_co8415981.1_g000001 Rmu_sc0003550.1_g000011 Rmu_sc0006572.1_g000001 Rmu_sc0037294.1_g000005
rosa_roxburghii	Rroxscaffold_6G00425750
rosa_rugosa	Rorug02G0602600
rosa_samantha	Rh3AG002900 Rh3BG002400 Rh3CG002700 Rh3DG002800
rosa_wichuraiana	Rw3G000180

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	2 cut(s)	686, 1186
AccB1I	GGYRCC	4 cut(s)	36, 251, 686, 1186
AciI	CCGC	3 cut(s)	293, 516, 1065
AclWI	GGATC	4 cut(s)	351, 360, 427, 1055
AcoI	YGGCCR	1 cut(s)	449
AcsI	RAATTY	1 cut(s)	796
AcuI	CTGAAG	1 cut(s)	747
AfaI	GTAC	9 cut(s)	98, 407, 688, 856, 901, 1054, 1116, 1165, 1188
AfiI	CCNNNNNNNGG	1 cut(s)	438
AflIII	ACRYGT	1 cut(s)	1169
AgsI	TTSAA	5 cut(s)	271, 466, 621, 795, 1047
AhlI	ACTAGT	2 cut(s)	734, 1157
AluBI	AGCT	7 cut(s)	479, 488, 636, 786, 932, 1006, 1196
AluI	AGCT	7 cut(s)	479, 488, 636, 786, 932, 1006, 1196
AlwI	GGATC	4 cut(s)	351, 360, 427, 1055
AlwNI	CAGNNNCTG	2 cut(s)	491, 866
AoxI	GGCC	3 cut(s)	449, 739, 984
ApoI	RAATTY	1 cut(s)	796
Asp718I	GGTACC	2 cut(s)	686, 1186
AspA2I	CCTAGG	1 cut(s)	100
AspLEI	GCGC	3 cut(s)	233, 508, 1000
AsuHPI	GGTGA	2 cut(s)	815, 983
AvrII	CCTAGG	1 cut(s)	100
BalI	TGGCCA	1 cut(s)	451
BanI	GGYRCC	4 cut(s)	36, 251, 686, 1186
BanII	GRGCYC	1 cut(s)	433
BarI	GAAGNNNNNNTAC	2 cut(s)	841, 873
BccI	CCATC	4 cut(s)	48, 248, 929, 962
BceAI	ACGGC	1 cut(s)	535
BclI	TGATCA	5 cut(s)	655, 712, 976, 1015, 1123
BcuI	ACTAGT	2 cut(s)	734, 1157
BfaI	CTAG	3 cut(s)	101, 735, 1158
BfmI	CTRYAG	3 cut(s)	303, 858, 1056
BfoI	RGCGCY	1 cut(s)	509
BlnI	CCTAGG	1 cut(s)	100
BmcAI	AGTACT	3 cut(s)	856, 1054, 1165
BmiI	GGNNCC	5 cut(s)	38, 253, 430, 688, 1188
BmsI	GCATC	4 cut(s)	32, 531, 779, 1084
BpmI	CTGGAG	2 cut(s)	242, 659
Bpu10I	CCTNAGC	1 cut(s)	787
BpuEI	CTTGAG	1 cut(s)	465
BsaBI	GATNNNNATC	5 cut(s)	312, 370, 654, 657, 1020
BsaJI	CCNNGG	5 cut(s)	100, 132, 163, 826, 888
Bsc4I	CCNNNNNNNGG	1 cut(s)	438
Bse1I	ACTGG	4 cut(s)	253, 676, 871, 1112
Bse3DI	GCAATG	3 cut(s)	144, 233, 406
Bse8I	GATNNNNATC	5 cut(s)	312, 370, 654, 657, 1020
BseDI	CCNNGG	5 cut(s)	100, 132, 163, 826, 888
BseGI	GGATG	4 cut(s)	655, 1021, 1126, 1213
BseJI	GATNNNNATC	5 cut(s)	312, 370, 654, 657, 1020
BseLI	CCNNNNNNNGG	1 cut(s)	438
BseMI	GCAATG	3 cut(s)	144, 233, 406
BseMII	CTCAG	2 cut(s)	423, 801
BseNI	ACTGG	4 cut(s)	253, 676, 871, 1112
BseRI	GAGGAG	3 cut(s)	46, 288, 486
BseYI	CCCAGC	1 cut(s)	432
BsgI	GTGCAG	1 cut(s)	463
BshFI	GGCC	3 cut(s)	451, 741, 986
BshNI	GGYRCC	4 cut(s)	36, 251, 686, 1186
BslFI	GGGAC	2 cut(s)	762, 877
BslI	CCNNNNNNNGG	1 cut(s)	438
BsmFI	GGGAC	2 cut(s)	762, 877
BsmI	GAATGC	1 cut(s)	461
BsnI	GGCC	3 cut(s)	451, 741, 986
Bsp1286I	GDGCHC	1 cut(s)	433
Bsp19I	CCATGG	2 cut(s)	826, 888
BspACI	CCGC	3 cut(s)	293, 516, 1065
BspANI	GGCC	3 cut(s)	451, 741, 986
BspCNI	CTCAG	2 cut(s)	422, 800
BspHI	TCATGA	2 cut(s)	393, 703
BspLI	GGNNCC	5 cut(s)	38, 253, 430, 688, 1188
BspMAI	CTGCAG	1 cut(s)	307
BspPI	GGATC	4 cut(s)	351, 360, 427, 1055
BspT107I	GGYRCC	4 cut(s)	36, 251, 686, 1186
BsrDI	GCAATG	3 cut(s)	144, 233, 406
BsrI	ACTGG	4 cut(s)	253, 676, 871, 1112
BssECI	CCNNGG	5 cut(s)	100, 132, 163, 826, 888
BssT1I	CCWWGG	3 cut(s)	100, 826, 888
Bst4CI	ACNGT	2 cut(s)	904, 1228
BstAPI	GCANNNNNTGC	1 cut(s)	491
BstC8I	GCNNGC	5 cut(s)	60, 520, 533, 599, 1084
BstDEI	CTNAG	2 cut(s)	409, 787
BstDSI	CCRYGG	2 cut(s)	826, 888
BstF5I	GGATG	4 cut(s)	655, 1021, 1126, 1213
BstH2I	RGCGCY	1 cut(s)	509
BstHHI	GCGC	3 cut(s)	233, 508, 1000
BstNSI	RCATGY	3 cut(s)	535, 581, 1173
BstSFI	CTRYAG	3 cut(s)	303, 858, 1056
BstX2I	RGATCY	3 cut(s)	365, 419, 1060
BstXI	CCANNNNNNTGG	1 cut(s)	47
BstYI	RGATCY	3 cut(s)	365, 419, 1060
BsuRI	GGCC	3 cut(s)	451, 741, 986
BtgI	CCRYGG	2 cut(s)	826, 888
BtsCI	GGATG	4 cut(s)	655, 1021, 1126, 1213
BtsI	GCAGTG	1 cut(s)	255
BtsIMutI	CAGTG	2 cut(s)	255, 1149
Cac8I	GCNNGC	5 cut(s)	60, 520, 533, 599, 1084
CaiI	CAGNNNCTG	2 cut(s)	491, 866
CciI	TCATGA	2 cut(s)	393, 703
CfoI	GCGC	3 cut(s)	233, 508, 1000
Csp6I	GTAC	9 cut(s)	97, 406, 687, 855, 900, 1053, 1115, 1164, 1187
CviQI	GTAC	9 cut(s)	97, 406, 687, 855, 900, 1053, 1115, 1164, 1187
DdeI	CTNAG	2 cut(s)	409, 787
EaeI	YGGCCR	1 cut(s)	449
Eco130I	CCWWGG	3 cut(s)	100, 826, 888
Eco24I	GRGCYC	1 cut(s)	433
Eco57I	CTGAAG	1 cut(s)	747
EcoT14I	CCWWGG	3 cut(s)	100, 826, 888
EcoT38I	GRGCYC	1 cut(s)	433
ErhI	CCWWGG	3 cut(s)	100, 826, 888
FaqI	GGGAC	2 cut(s)	762, 877
FauI	CCCGC	1 cut(s)	1072
FauNDI	CATATG	2 cut(s)	139, 415
FbaI	TGATCA	5 cut(s)	655, 712, 976, 1015, 1123
FokI	GGATG	4 cut(s)	662, 1008, 1133, 1200
FriOI	GRGCYC	1 cut(s)	433
FspBI	CTAG	3 cut(s)	101, 735, 1158
GlaI	GCGC	3 cut(s)	232, 507, 999
GsaI	CCCAGC	1 cut(s)	436
GsuI	CTGGAG	2 cut(s)	242, 659
HaeII	RGCGCY	1 cut(s)	509
HaeIII	GGCC	3 cut(s)	451, 741, 986
HhaI	GCGC	3 cut(s)	233, 508, 1000
Hin6I	GCGC	3 cut(s)	231, 506, 998
HinP1I	GCGC	3 cut(s)	231, 506, 998
HincII	GTYRAC	1 cut(s)	668
HindII	GTYRAC	1 cut(s)	668
HinfI	GANTC	3 cut(s)	75, 758, 1133
HphI	GGTGA	2 cut(s)	815, 983
Hpy166II	GTNNAC	2 cut(s)	406, 668
Hpy188I	TCNGA	3 cut(s)	164, 321, 365
Hpy188III	TCNNGA	7 cut(s)	221, 394, 626, 647, 704, 980, 1231
Hpy8I	GTNNAC	2 cut(s)	406, 668
Hpy99I	CGWCG	1 cut(s)	1141
HpyCH4III	ACNGT	2 cut(s)	904, 1228
HpyCH4IV	ACGT	1 cut(s)	276
HpyF3I	CTNAG	2 cut(s)	409, 787
HpySE526I	ACGT	1 cut(s)	276
HspAI	GCGC	3 cut(s)	231, 506, 998
KpnI	GGTACC	2 cut(s)	690, 1190
Ksp22I	TGATCA	5 cut(s)	655, 712, 976, 1015, 1123
LmnI	GCTCC	3 cut(s)	428, 499, 633
LweI	GCATC	4 cut(s)	32, 531, 779, 1084
MaeI	CTAG	3 cut(s)	101, 735, 1158
MaeII	ACGT	1 cut(s)	276
MaeIII	GTNAC	2 cut(s)	178, 1172
MboII	GAAGA	3 cut(s)	653, 753, 1100
MflI	RGATCY	3 cut(s)	365, 419, 1060
MhlI	GDGCHC	1 cut(s)	433
MlsI	TGGCCA	1 cut(s)	451
MluCI	AATT	4 cut(s)	616, 694, 796, 1180
MluNI	TGGCCA	1 cut(s)	451
MlyI	GAGTC	1 cut(s)	84
MmeI	TCCRAC	1 cut(s)	1226
Mox20I	TGGCCA	1 cut(s)	451
MscI	TGGCCA	1 cut(s)	451
MseI	TTAA	2 cut(s)	171, 993
MslI	CAYNNNNRTG	4 cut(s)	45, 648, 708, 893
Msp20I	TGGCCA	1 cut(s)	451
MspA1I	CMGCKG	3 cut(s)	488, 518, 1196
Mva1269I	GAATGC	1 cut(s)	461
NcoI	CCATGG	2 cut(s)	826, 888
NdeI	CATATG	2 cut(s)	139, 415
NlaIV	GGNNCC	5 cut(s)	38, 253, 430, 688, 1188
NmeAIII	GCCGAG	1 cut(s)	157
NspI	RCATGY	3 cut(s)	535, 581, 1173
PaeI	GCATGC	1 cut(s)	535
PagI	TCATGA	2 cut(s)	393, 703
PciI	ACATGT	1 cut(s)	1169
PctI	GAATGC	1 cut(s)	461
PfeI	GAWTC	2 cut(s)	758, 1133
PleI	GAGTC	1 cut(s)	83
PpsI	GAGTC	1 cut(s)	83
PscI	ACATGT	1 cut(s)	1169
PspFI	CCCAGC	1 cut(s)	432
PspN4I	GGNNCC	5 cut(s)	38, 253, 430, 688, 1188
PstI	CTGCAG	1 cut(s)	307
PstNI	CAGNNNCTG	2 cut(s)	491, 866
PsuI	RGATCY	3 cut(s)	365, 419, 1060
PvuII	CAGCTG	2 cut(s)	488, 1196
RsaI	GTAC	9 cut(s)	98, 407, 688, 856, 901, 1054, 1116, 1165, 1188
RsaNI	GTAC	9 cut(s)	97, 406, 687, 855, 900, 1053, 1115, 1164, 1187
RseI	CAYNNNNRTG	4 cut(s)	45, 648, 708, 893
SaqAI	TTAA	2 cut(s)	171, 993
ScaI	AGTACT	3 cut(s)	856, 1054, 1165
SchI	GAGTC	1 cut(s)	84
SduI	GDGCHC	1 cut(s)	433
SfaNI	GCATC	4 cut(s)	32, 531, 779, 1084
SfcI	CTRYAG	3 cut(s)	303, 858, 1056
SmiMI	CAYNNNNRTG	4 cut(s)	45, 648, 708, 893
SmlI	CTYRAG	1 cut(s)	480
SmoI	CTYRAG	1 cut(s)	480
SpeI	ACTAGT	2 cut(s)	734, 1157
SphI	GCATGC	1 cut(s)	535
Sse9I	AATT	4 cut(s)	616, 694, 796, 1180
SsiI	CCGC	3 cut(s)	293, 516, 1065
SspI	AATATT	1 cut(s)	991
SspMI	CTAG	3 cut(s)	101, 735, 1158
StyI	CCWWGG	3 cut(s)	100, 826, 888
TaaI	ACNGT	2 cut(s)	904, 1228
TaiI	ACGT	1 cut(s)	279
TasI	AATT	4 cut(s)	616, 694, 796, 1180
TatI	WGTACW	6 cut(s)	405, 854, 899, 1052, 1114, 1163
TauI	GCSGC	2 cut(s)	295, 518
TfiI	GAWTC	2 cut(s)	758, 1133
Tru1I	TTAA	2 cut(s)	171, 993
Tru9I	TTAA	2 cut(s)	171, 993
TscAI	CASTG	2 cut(s)	262, 1149
TspDTI	ATGAA	4 cut(s)	629, 692, 1146, 1193
TspGWI	ACGGA	1 cut(s)	366
TspRI	CASTG	2 cut(s)	262, 1149
XapI	RAATTY	1 cut(s)	796
XceI	RCATGY	3 cut(s)	535, 581, 1173
XmaJI	CCTAGG	1 cut(s)	100
XspI	CTAG	3 cut(s)	101, 735, 1158
ZrmI	AGTACT	3 cut(s)	856, 1054, 1165

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.