Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007029.1

Orthogroup ID

OG0007065

Physical Location & Seq

Genomic Coordinates Forward (+)

101876 .. 105314

Gene Structure 3439 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007029.1_g000024.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 2232 bp

atggagggaagagagaacagccatcatcctctgttgagaggtggcaggagtagcaagttcagccatggcttctccgcagctcaaatccgatcacttgctgccatgtgtgaagctctcatacctcctctgccactggacaccgatgaccaagcccttcactccttctacaaagcttctgggtctgagcctcctataccagatgaggtagcagattttataatgaaggggagtatacccgaagctgtgggagtactgtcctttttcctgaaggtcttgtcctacagattagggactttactggtttgcgggtatccttgcctcgaaagtaggtggcctttcgttcacaactttgctgaaatgtctttggagaagagagaagaagctctgcagagatggtcaaaggaaaagcgtctgatacctctaagactgttgtttttggtggtcaagatcttctgcttctactgcttcttctccaggattgttaaagattcagagaacccgtcatggaaagcgacaggatacaatgtaaacaagagagaaaagtttatcaaaactcccaaggagagacctcttgagaagggaatcatagaaaccatgactaaaaccgactctactctcattgaatccctcaccaagaaaggcattgaagtcacggacagcgctgctcatccaaagatccacaagatcaaatgtgatgttgtcgttgttggctctggttgtggtggaggagttgcagctgcagttctagcacagtcgggccaaaaagtagttgtccttgaaaaagggaactactttgtccccaaagactattctcttctagaaggtccttccatgaatgagctatatgaatctggtggaatcatggcatcaaaagatgggaagataatgatattggctggttcaacagttgggggaggctctgctgtgaactggtctgcatctatcaaaaccccgaattctgttcttgaagagtggtctgtggatcataagattccacttttcggtagccctgactatcaatctgcaatggatgctgtgtgtaagaggattggcgttgtagatagttgtactgaggaaaacatgcagaatcagattttaagaaaagggtgtgagaaacttggtttgaaagttgattcagtcccaagaaactcctcagcagatcactactgtggttcttgcaattacggttgcccaactggagataaacaagggactgatagaacttggctagttgatgctgtcaaatgtggtgctgtgattttaacaggttgcaaagctgagagattcataatcgaaaatgactatcaaggaggtacaagcaggaaaagaagccttggagtgcaagcaatatctttgtgcaagaacataacaaagaagcttcacattgaggccaaggtgacaatttcagcatgcgggtctctcttgacacctcctctaatgatctccagtggactcaagaacccaaacattggcagaaacctccatcttcaccctgttctgctagcttgggggtacttccccgaacattcatcagaatttaaaggcaaaacttttgagggtggaatcatcacttcactccataaggttgtttctgaggacaacccaaatgtcagagccattgtagaaactccagcactagggcctgcctcatttgccactttagtcccatgggtttcgggacttgacatgaaggacagaatggccaagtatgcaagaacagctcacctttttgcattggtcagagatcagggctcaggagaggtcagggtggagaacaggatccactacagattgaacagatcagacaaagaaaacatacaagctgggcttaggcaggctttgagaatattgattgctgcaggggctgctgaagtgggtacatacagaaatgatgggcagagaattgtgtgcgaggggactaaggaggaggatttggaagagttcttagacagtgtaatcgcagtaggaggaccgagaacaaaaggcgagaactggacaatgtattcttctgcacatcagatggggagttgtagaatgggtgctactgagaaagaaggaggggttgatgagaatggtgagagttgggaggcaaaggggttgtttgtgtgtgatggaagtgtgcttccaacagctgttggtgtcaatcccatgattactatccaatccacagcttattgcctttccaagaagattgcaaattcattgaagaaggaaaagttcatggttgattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0008150 GO:0008152 GO:0012505 GO:0016491 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0055114

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GMC_oxred_C GMC_oxred_N

Protein Analysis

743

Amino Acids

81.23

Weight (kDa)

8.41

Isoelectric Point (pI)

38.63

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007065)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G28570 AT4G28570
fragaria_vesca	FvH4_2g21000 FvH4_2g21000 FvH4_2g21000 FvH4_2g21000 FvH4_2g21000 FvH4_2g21000 FvH4_2g21040
malus_domestica	MD05G1193200.v1.1 MD10G1179700.v1.1
prunus_persica	Prupe.8G219700_v2.0.a1
pyrus_communis	pycom05g18010
rosa_chinensis	RchiOBHm_Chr6g0287381
rosa_laevigata	RLG00000012493
rosa_multiflora	Rmu_sc0007029.1_g000024
rosa_roxburghii	Rroxscaffold_7G00181480
rosa_rugosa	Rorug06G0187800 Rorug06G0187900
rosa_samantha	Rh6AG299000 Rh6BG304600 Rh6CG305100 Rh6CG313100 Rh6DG296400
rosa_wichuraiana	Rw6G025840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	218
AccB7I	CCANNNNNTGG	1 cut(s)	1469
AccI	GTMKAC	1 cut(s)	232
AciI	CCGC	3 cut(s)	75, 306, 1413
AclWI	GGATC	4 cut(s)	670, 990, 1774, 1787
AcoI	YGGCCR	1 cut(s)	1701
AcsI	RAATTY	3 cut(s)	955, 1535, 2197
AcuI	CTGAAG	2 cut(s)	287, 1890
AfaI	GTAC	5 cut(s)	252, 1069, 1315, 1514, 1879
AfeI	AGCGCT	1 cut(s)	661
AfiI	CCNNNNNNNGG	3 cut(s)	1001, 1469, 1637
AgsI	TTSAA	8 cut(s)	623, 647, 779, 903, 968, 1126, 1795, 2206
AjnI	CCWGG	1 cut(s)	473
AleI	CACNNNNGTG	1 cut(s)	1167
Alw26I	GTCTC	2 cut(s)	559, 1422
AlwI	GGATC	4 cut(s)	670, 990, 1774, 1787
AlwNI	CAGNNNCTG	1 cut(s)	1865
Aor51HI	AGCGCT	1 cut(s)	661
AoxI	GGCC	5 cut(s)	332, 757, 1389, 1640, 1701
ApeKI	GCWGC	7 cut(s)	77, 98, 662, 734, 737, 1856, 1865
ApoI	RAATTY	3 cut(s)	955, 1535, 2197
AspLEI	GCGC	1 cut(s)	662
AspS9I	GGNCC	4 cut(s)	757, 824, 1640, 1970
AsuHPI	GGTGA	5 cut(s)	622, 1408, 1481, 1715, 2087
AsuNHI	GCTAGC	1 cut(s)	1501
AvaII	GGWCC	2 cut(s)	824, 1970
BalI	TGGCCA	1 cut(s)	1703
BamHI	GGATCC	1 cut(s)	1779
BanII	GRGCYC	1 cut(s)	1754
BarI	GAAGNNNNNNTAC	2 cut(s)	102, 134
BbvCI	CCTCAGC	1 cut(s)	1153
BbvI	GCAGC	7 cut(s)	85, 89, 649, 724, 746, 1843, 1852
BccI	CCATC	7 cut(s)	30, 387, 869, 1491, 1886, 2014, 2105
BciT130I	CCWGG	1 cut(s)	475
BciVI	GTATCC	2 cut(s)	321, 512
BcoDI	GTCTC	2 cut(s)	559, 1422
BfaI	CTAG	5 cut(s)	746, 818, 1229, 1502, 1637
BfmI	CTRYAG	5 cut(s)	280, 386, 738, 1786, 1857
BfoI	RGCGCY	1 cut(s)	663
BfuI	GTATCC	2 cut(s)	321, 512
BglII	AGATCT	1 cut(s)	447
BisI	GCNGC	7 cut(s)	78, 99, 663, 735, 738, 1857, 1866
BlsI	GCNGC	7 cut(s)	79, 100, 664, 736, 739, 1858, 1867
BmcAI	AGTACT	1 cut(s)	252
Bme1390I	CCNGG	1 cut(s)	475
Bme18I	GGWCC	2 cut(s)	824, 1970
BmgT120I	GGNCC	4 cut(s)	757, 824, 1640, 1970
BmiI	GGNNCC	1 cut(s)	1781
BmrFI	CCNGG	1 cut(s)	475
BmsI	GCATC	4 cut(s)	875, 947, 1021, 1225
BmtI	GCTAGC	1 cut(s)	1505
BpmI	CTGGAG	4 cut(s)	457, 1218, 1429, 1614
Bpu10I	CCTNAGC	3 cut(s)	1153, 1753, 1829
BpuEI	CTTGAG	2 cut(s)	593, 1439
BsaBI	GATNNNNATC	1 cut(s)	2156
BsaI	GGTCTC	2 cut(s)	559, 1422
BsaJI	CCNNGG	5 cut(s)	64, 558, 1333, 1392, 1667
Bsc4I	CCNNNNNNNGG	3 cut(s)	1001, 1469, 1637
Bse1I	ACTGG	6 cut(s)	138, 303, 935, 1201, 1446, 1997
Bse3DI	GCAATG	1 cut(s)	1032
Bse8I	GATNNNNATC	1 cut(s)	2156
BseBI	CCWGG	1 cut(s)	475
BseDI	CCNNGG	5 cut(s)	64, 558, 1333, 1392, 1667
BseGI	GGATG	3 cut(s)	25, 667, 1036
BseJI	GATNNNNATC	1 cut(s)	2156
BseLI	CCNNNNNNNGG	3 cut(s)	1001, 1469, 1637
BseMI	GCAATG	1 cut(s)	1032
BseMII	CTCAG	7 cut(s)	174, 1062, 1167, 1269, 1584, 1767, 2037
BseNI	ACTGG	6 cut(s)	138, 303, 935, 1201, 1446, 1997
BseRI	GAGGAG	5 cut(s)	114, 741, 1141, 1422, 1940
BseXI	GCAGC	7 cut(s)	85, 89, 649, 724, 746, 1843, 1852
BseYI	CCCAGC	1 cut(s)	1823
BsgI	GTGCAG	1 cut(s)	1995
BshFI	GGCC	5 cut(s)	334, 759, 1391, 1642, 1703
BslFI	GGGAC	7 cut(s)	304, 782, 1124, 1225, 1649, 1692, 1930
BslI	CCNNNNNNNGG	3 cut(s)	1001, 1469, 1637
BsmAI	GTCTC	2 cut(s)	559, 1422
BsmFI	GGGAC	7 cut(s)	304, 782, 1124, 1225, 1649, 1692, 1930
BsnI	GGCC	5 cut(s)	334, 759, 1391, 1642, 1703
Bso31I	GGTCTC	2 cut(s)	559, 1422
Bsp1286I	GDGCHC	1 cut(s)	1754
Bsp19I	CCATGG	2 cut(s)	64, 1667
BspACI	CCGC	3 cut(s)	75, 306, 1413
BspANI	GGCC	5 cut(s)	334, 759, 1391, 1642, 1703
BspCNI	CTCAG	7 cut(s)	175, 1063, 1166, 1270, 1585, 1766, 2038
BspLI	GGNNCC	1 cut(s)	1781
BspMAI	CTGCAG	3 cut(s)	390, 742, 1861
BspOI	GCTAGC	1 cut(s)	1505
BspPI	GGATC	4 cut(s)	670, 990, 1774, 1787
BspTNI	GGTCTC	2 cut(s)	559, 1422
BsrDI	GCAATG	1 cut(s)	1032
BsrI	ACTGG	6 cut(s)	138, 303, 935, 1201, 1446, 1997
BssECI	CCNNGG	5 cut(s)	64, 558, 1333, 1392, 1667
BssNAI	GTATAC	1 cut(s)	233
BssT1I	CCWWGG	5 cut(s)	64, 558, 1333, 1392, 1667
Bst1107I	GTATAC	1 cut(s)	233
Bst2UI	CCWGG	1 cut(s)	475
Bst4CI	ACNGT	7 cut(s)	255, 429, 753, 907, 1169, 1187, 1952
Bst6I	CTCTTC	5 cut(s)	4, 365, 819, 963, 1932
BstAPI	GCANNNNNTGC	2 cut(s)	1031, 1865
BstC8I	GCNNGC	5 cut(s)	1344, 1411, 1503, 1644, 1836
BstDSI	CCRYGG	2 cut(s)	64, 1667
BstF5I	GGATG	3 cut(s)	25, 667, 1036
BstH2I	RGCGCY	1 cut(s)	663
BstHHI	GCGC	1 cut(s)	662
BstMAI	GTCTC	2 cut(s)	559, 1422
BstNI	CCWGG	1 cut(s)	475
BstNSI	RCATGY	2 cut(s)	1084, 1413
BstSCI	CCNGG	1 cut(s)	473
BstSFI	CTRYAG	5 cut(s)	280, 386, 738, 1786, 1857
BstV1I	GCAGC	7 cut(s)	85, 89, 649, 724, 746, 1843, 1852
BstX2I	RGATCY	3 cut(s)	447, 675, 1779
BstYI	RGATCY	3 cut(s)	447, 675, 1779
BstZ17I	GTATAC	1 cut(s)	233
BsuI	GTATCC	2 cut(s)	321, 512
BsuRI	GGCC	5 cut(s)	334, 759, 1391, 1642, 1703
BtgI	CCRYGG	2 cut(s)	64, 1667
BtsCI	GGATG	3 cut(s)	25, 667, 1036
BtsIMutI	CAGTG	3 cut(s)	131, 1453, 1957
Cac8I	GCNNGC	5 cut(s)	1344, 1411, 1503, 1644, 1836
CaiI	CAGNNNCTG	1 cut(s)	1865
CfoI	GCGC	1 cut(s)	662
Cfr13I	GGNCC	4 cut(s)	757, 824, 1640, 1970
CseI	GACGC	1 cut(s)	398
Csp6I	GTAC	5 cut(s)	251, 1068, 1314, 1513, 1878
CviQI	GTAC	5 cut(s)	251, 1068, 1314, 1513, 1878
DraI	TTTAAA	1 cut(s)	1540
EaeI	YGGCCR	1 cut(s)	1701
Eam1104I	CTCTTC	5 cut(s)	4, 365, 819, 963, 1932
EarI	CTCTTC	5 cut(s)	4, 365, 819, 963, 1932
Eco130I	CCWWGG	5 cut(s)	64, 558, 1333, 1392, 1667
Eco24I	GRGCYC	1 cut(s)	1754
Eco31I	GGTCTC	2 cut(s)	559, 1422
Eco47I	GGWCC	2 cut(s)	824, 1970
Eco47III	AGCGCT	1 cut(s)	661
Eco57I	CTGAAG	2 cut(s)	287, 1890
EcoO109I	RGGNCCY	2 cut(s)	824, 1640
EcoRI	GAATTC	1 cut(s)	955
EcoRII	CCWGG	1 cut(s)	473
EcoT14I	CCWWGG	5 cut(s)	64, 558, 1333, 1392, 1667
EcoT38I	GRGCYC	1 cut(s)	1754
ErhI	CCWWGG	5 cut(s)	64, 558, 1333, 1392, 1667
FalI	AAGNNNNNCTT	2 cut(s)	1812, 1844
FaqI	GGGAC	7 cut(s)	304, 782, 1124, 1225, 1649, 1692, 1930
FauI	CCCGC	2 cut(s)	299, 1406
FblI	GTMKAC	1 cut(s)	232
Fnu4HI	GCNGC	7 cut(s)	78, 99, 663, 735, 738, 1857, 1866
FokI	GGATG	3 cut(s)	12, 654, 1043
FriOI	GRGCYC	1 cut(s)	1754
Fsp4HI	GCNGC	7 cut(s)	78, 99, 663, 735, 738, 1857, 1866
FspBI	CTAG	5 cut(s)	746, 818, 1229, 1502, 1637
GlaI	GCGC	1 cut(s)	661
GluI	GCNGC	7 cut(s)	78, 99, 663, 735, 738, 1857, 1866
GsaI	CCCAGC	1 cut(s)	1827
GsuI	CTGGAG	4 cut(s)	457, 1218, 1429, 1614
HaeII	RGCGCY	1 cut(s)	663
HaeIII	GGCC	5 cut(s)	334, 759, 1391, 1642, 1703
HgaI	GACGC	1 cut(s)	398
HhaI	GCGC	1 cut(s)	662
Hin6I	GCGC	1 cut(s)	660
HinP1I	GCGC	1 cut(s)	660
HindIII	AAGCTT	2 cut(s)	171, 1376
HphI	GGTGA	5 cut(s)	622, 1408, 1481, 1715, 2087
Hpy166II	GTNNAC	5 cut(s)	233, 343, 529, 928, 1451
Hpy188III	TCNNGA	9 cut(s)	265, 445, 572, 818, 965, 1423, 1456, 1677, 1755
Hpy8I	GTNNAC	5 cut(s)	233, 343, 529, 928, 1451
HpyCH4III	ACNGT	7 cut(s)	255, 429, 753, 907, 1169, 1187, 1952
HspAI	GCGC	1 cut(s)	660
Lsp1109I	GCAGC	7 cut(s)	85, 89, 649, 724, 746, 1843, 1852
LweI	GCATC	4 cut(s)	875, 947, 1021, 1225
MaeI	CTAG	5 cut(s)	746, 818, 1229, 1502, 1637
MaeIII	GTNAC	2 cut(s)	649, 1396
MflI	RGATCY	3 cut(s)	447, 675, 1779
MhlI	GDGCHC	1 cut(s)	1754
MlsI	TGGCCA	1 cut(s)	1703
MluCI	AATT	6 cut(s)	955, 1180, 1401, 1535, 1902, 2197
MluNI	TGGCCA	1 cut(s)	1703
MlyI	GAGTC	2 cut(s)	602, 1446
MmeI	TCCRAC	1 cut(s)	2150
Mox20I	TGGCCA	1 cut(s)	1703
MscI	TGGCCA	1 cut(s)	1703
MseI	TTAA	4 cut(s)	483, 1097, 1262, 1539
MslI	CAYNNNNRTG	1 cut(s)	1167
Msp20I	TGGCCA	1 cut(s)	1703
MspA1I	CMGCKG	2 cut(s)	737, 2132
MspR9I	CCNGG	1 cut(s)	475
MvaI	CCWGG	1 cut(s)	475
NcoI	CCATGG	2 cut(s)	64, 1667
NheI	GCTAGC	1 cut(s)	1501
NlaIV	GGNNCC	1 cut(s)	1781
NmuCI	GTSAC	2 cut(s)	649, 1396
NspI	RCATGY	2 cut(s)	1084, 1413
OliI	CACNNNNGTG	1 cut(s)	1167
PaeI	GCATGC	1 cut(s)	1413
PflMI	CCANNNNNTGG	1 cut(s)	1469
PfoI	TCCNGGA	1 cut(s)	473
PkrI	GCNGC	7 cut(s)	79, 100, 664, 736, 739, 1858, 1867
PleI	GAGTC	2 cut(s)	602, 1446
PpsI	GAGTC	2 cut(s)	602, 1446
PpuMI	RGGWCCY	1 cut(s)	824
PsiI	TTATAA	1 cut(s)	218
Psp5II	RGGWCCY	1 cut(s)	824
Psp6I	CCWGG	1 cut(s)	473
PspFI	CCCAGC	1 cut(s)	1823
PspGI	CCWGG	1 cut(s)	473
PspN4I	GGNNCC	1 cut(s)	1781
PspPI	GGNCC	4 cut(s)	757, 824, 1640, 1970
PspPPI	RGGWCCY	1 cut(s)	824
PstI	CTGCAG	3 cut(s)	390, 742, 1861
PstNI	CAGNNNCTG	1 cut(s)	1865
PsuI	RGATCY	3 cut(s)	447, 675, 1779
PvuII	CAGCTG	2 cut(s)	737, 2132
RsaI	GTAC	5 cut(s)	252, 1069, 1315, 1514, 1879
RsaNI	GTAC	5 cut(s)	251, 1068, 1314, 1513, 1878
RseI	CAYNNNNRTG	1 cut(s)	1167
SaqAI	TTAA	4 cut(s)	483, 1097, 1262, 1539
SatI	GCNGC	7 cut(s)	78, 99, 663, 735, 738, 1857, 1866
Sau96I	GGNCC	4 cut(s)	757, 824, 1640, 1970
ScaI	AGTACT	1 cut(s)	252
SchI	GAGTC	2 cut(s)	602, 1446
ScrFI	CCNGG	1 cut(s)	475
SduI	GDGCHC	1 cut(s)	1754
SfaNI	GCATC	4 cut(s)	875, 947, 1021, 1225
SfcI	CTRYAG	5 cut(s)	280, 386, 738, 1786, 1857
SinI	GGWCC	2 cut(s)	824, 1970
SmiMI	CAYNNNNRTG	1 cut(s)	1167
SmlI	CTYRAG	2 cut(s)	572, 1454
SmoI	CTYRAG	2 cut(s)	572, 1454
SphI	GCATGC	1 cut(s)	1413
Sse9I	AATT	6 cut(s)	955, 1180, 1401, 1535, 1902, 2197
SsiI	CCGC	3 cut(s)	75, 306, 1413
SspI	AATATT	1 cut(s)	1848
SspMI	CTAG	5 cut(s)	746, 818, 1229, 1502, 1637
StyD4I	CCNGG	1 cut(s)	473
StyI	CCWWGG	5 cut(s)	64, 558, 1333, 1392, 1667
TaaI	ACNGT	7 cut(s)	255, 429, 753, 907, 1169, 1187, 1952
TaqI	TCGA	2 cut(s)	321, 1293
TaqII	GACCGA	1 cut(s)	1987
TasI	AATT	6 cut(s)	955, 1180, 1401, 1535, 1902, 2197
TatI	WGTACW	2 cut(s)	250, 1067
Tru1I	TTAA	4 cut(s)	483, 1097, 1262, 1539
Tru9I	TTAA	4 cut(s)	483, 1097, 1262, 1539
TscAI	CASTG	3 cut(s)	138, 1453, 1957
TseFI	GTSAC	2 cut(s)	649, 1396
TseI	GCWGC	7 cut(s)	77, 98, 662, 734, 737, 1856, 1865
Tsp45I	GTSAC	2 cut(s)	649, 1396
TspDTI	ATGAA	8 cut(s)	236, 848, 861, 1276, 1518, 1703, 2190, 2209
TspGWI	ACGGA	1 cut(s)	668
TspRI	CASTG	3 cut(s)	138, 1453, 1957
Van91I	CCANNNNNTGG	1 cut(s)	1469
VpaK11BI	GGWCC	2 cut(s)	824, 1970
XapI	RAATTY	3 cut(s)	955, 1535, 2197
XbaI	TCTAGA	1 cut(s)	817
XceI	RCATGY	2 cut(s)	1084, 1413
XmiI	GTMKAC	1 cut(s)	232
XspI	CTAG	5 cut(s)	746, 818, 1229, 1502, 1637
ZrmI	AGTACT	1 cut(s)	252

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.