Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007727.1

Orthogroup ID

OG0008311

Physical Location & Seq

Genomic Coordinates Forward (+)

105672 .. 106634

Gene Structure 963 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007727.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 963 bp

atggaacaattctggcgtattggagaggttttggggagtatgaaggcactgatggtcttacaagatggtatcaagatcaatcaagggcagtgctgtctattgcttgatatcttgactttggcatttgagacaattggggaggagatcaggctgaacctgaaattggaggagaaaaagaccaaatggaagggcctagatgaacctctgagggagctctacacagttttcagagaaagcgagatttacatcagaagctgcatggatgccaaagactggtggggcaaagcagtcatcctccatcagaacaaggactgtgtcgaattttacatacataatttgttctgctacttctcggctgtcattgaggcaatcgagaacgctggagagattgcggggctggaccaggatgagatgcagaagaagaggattgtgcttaagaggaagtatgataaggattggaatgacccgaaacttttccagtggagatttgggaagcagtatttggtcccgaagacgatgtgcaaaaggttggagagtgcttggagggaagatagatggcggctcattgaagcactcaaggagaagaaattagctgttggtttgacaaagaatgagcagcagctcggagacttgctgcttaagaaactacacggggcagagtttttgaatgggaaactgtttccgagctcaattttattaggagctaaggattacaacattaagcggcggttaggaaatggacggcagtacaaggaaatccactggttggggcacaactttgccatgagacatttctttggggaacttgaaccgttcagttctgagatttcgactctcctttcactctcccaccccagtgtactgcaatacctttgcgggttttatgatgaagataagaaggaatgcttccttgttatggagttgatgagcaaggatctctgttgctatacattagacgcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF1221 Pkinase_Tyr

Protein Analysis

320

Amino Acids

37.62

Weight (kDa)

7.52

Isoelectric Point (pI)

47.87

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008311)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64300 AT1G64300 AT5G41730 AT5G41730
fragaria_vesca	FvH4_5g03980 FvH4_5g03980 FvH4_5g03980
malus_domestica	MD06G1101300.v1.1 MD14G1121000.v1.1
prunus_persica	Prupe.5G114700_v2.0.a1 Prupe.5G114700_v2.0.a1
pyrus_communis	pycom06g09650
rosa_chinensis	RchiOBHm_Chr7g0195511
rosa_laevigata	RLG00000004113
rosa_multiflora	Rmu_sc0007727.1_g000023 Rmu_ssc0000078.1_g000002
rosa_rugosa	Rorug07G0023900
rosa_samantha	Rh7AG151500 Rh7BG153200 Rh7CG156700 Rh7DG152500
rosa_wichuraiana	Rw2G030980 Rw7G012940

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	273, 766
AciI	CCGC	5 cut(s)	392, 559, 724, 727, 876
AclWI	GGATC	1 cut(s)	942
AcsI	RAATTY	1 cut(s)	320
AfaI	GTAC	2 cut(s)	749, 861
AfiI	CCNNNNNNNGG	4 cut(s)	163, 273, 766, 916
AflII	CTTAAG	2 cut(s)	434, 638
AgsI	TTSAA	3 cut(s)	569, 667, 809
AjnI	CCWGG	1 cut(s)	402
AjuI	GAANNNNNNNTTGG	4 cut(s)	146, 178, 485, 517
AleI	CACNNNNGTG	1 cut(s)	855
AluBI	AGCT	6 cut(s)	214, 255, 593, 622, 687, 704
AluI	AGCT	6 cut(s)	214, 255, 593, 622, 687, 704
Alw21I	GWGCWC	2 cut(s)	216, 689
Alw26I	GTCTC	3 cut(s)	122, 621, 781
AlwI	GGATC	1 cut(s)	942
AlwNI	CAGNNNCTG	1 cut(s)	255
AoxI	GGCC	1 cut(s)	190
ApeKI	GCWGC	4 cut(s)	255, 616, 619, 634
ApoI	RAATTY	1 cut(s)	320
Asp700I	GAANNNNTTC	1 cut(s)	473
AspS9I	GGNCC	3 cut(s)	190, 400, 505
AvaII	GGWCC	2 cut(s)	400, 505
BaeGI	GKGCMC	1 cut(s)	774
BanII	GRGCYC	2 cut(s)	216, 689
BbsI	GAAGAC	1 cut(s)	518
Bbv12I	GWGCWC	2 cut(s)	216, 689
BbvI	GCAGC	4 cut(s)	242, 621, 628, 631
BccI	CCATC	4 cut(s)	46, 59, 306, 549
BceAI	ACGGC	1 cut(s)	758
BciT130I	CCWGG	1 cut(s)	404
BcoDI	GTCTC	3 cut(s)	122, 621, 781
BfaI	CTAG	1 cut(s)	194
BfrI	CTTAAG	2 cut(s)	434, 638
BisI	GCNGC	6 cut(s)	256, 560, 617, 620, 635, 725
BlsI	GCNGC	6 cut(s)	257, 561, 618, 621, 636, 726
Bme1390I	CCNGG	1 cut(s)	404
Bme18I	GGWCC	2 cut(s)	400, 505
BmgT120I	GGNCC	3 cut(s)	190, 400, 505
BmiI	GGNNCC	1 cut(s)	507
BmrFI	CCNGG	1 cut(s)	404
BmrI	ACTGGG	1 cut(s)	849
BmsI	GCATC	2 cut(s)	253, 402
BmuI	ACTGGG	1 cut(s)	849
BpiI	GAAGAC	1 cut(s)	518
BpmI	CTGGAG	1 cut(s)	402
Bpu10I	CCTNAGC	1 cut(s)	705
BpuEI	CTTGAG	1 cut(s)	560
BsaBI	GATNNNNATC	1 cut(s)	245
Bsc4I	CCNNNNNNNGG	4 cut(s)	163, 273, 766, 916
Bse1I	ACTGG	4 cut(s)	278, 478, 767, 855
Bse8I	GATNNNNATC	1 cut(s)	245
BseBI	CCWGG	1 cut(s)	404
BseGI	GGATG	3 cut(s)	268, 291, 412
BseJI	GATNNNNATC	1 cut(s)	245
BseLI	CCNNNNNNNGG	4 cut(s)	163, 273, 766, 916
BseMII	CTCAG	2 cut(s)	197, 813
BseNI	ACTGG	4 cut(s)	278, 478, 767, 855
BseRI	GAGGAG	2 cut(s)	155, 182
BseSI	GKGCMC	1 cut(s)	774
BseXI	GCAGC	4 cut(s)	242, 621, 628, 631
BshFI	GGCC	1 cut(s)	192
BsiHKAI	GWGCWC	2 cut(s)	216, 689
BslFI	GGGAC	1 cut(s)	491
BslI	CCNNNNNNNGG	4 cut(s)	163, 273, 766, 916
BsmAI	GTCTC	3 cut(s)	122, 621, 781
BsmFI	GGGAC	1 cut(s)	491
BsmI	GAATGC	1 cut(s)	908
BsnI	GGCC	1 cut(s)	192
Bsp1286I	GDGCHC	3 cut(s)	216, 689, 774
Bsp143I	GATC	3 cut(s)	75, 144, 934
BspACI	CCGC	5 cut(s)	392, 559, 724, 727, 876
BspANI	GGCC	1 cut(s)	192
BspCNI	CTCAG	2 cut(s)	198, 814
BspLI	GGNNCC	1 cut(s)	507
BspPI	GGATC	1 cut(s)	942
BspTI	CTTAAG	2 cut(s)	434, 638
BsrI	ACTGG	4 cut(s)	278, 478, 767, 855
BssMI	GATC	3 cut(s)	75, 144, 934
Bst2UI	CCWGG	1 cut(s)	404
Bst4CI	ACNGT	4 cut(s)	223, 314, 678, 813
Bst6I	CTCTTC	1 cut(s)	416
BstAFI	CTTAAG	2 cut(s)	434, 638
BstDEI	CTNAG	3 cut(s)	206, 705, 822
BstF5I	GGATG	3 cut(s)	268, 291, 412
BstKTI	GATC	3 cut(s)	78, 147, 937
BstMAI	GTCTC	3 cut(s)	122, 621, 781
BstMBI	GATC	3 cut(s)	75, 144, 934
BstNI	CCWGG	1 cut(s)	404
BstSCI	CCNGG	1 cut(s)	402
BstSLI	GKGCMC	1 cut(s)	774
BstV1I	GCAGC	4 cut(s)	242, 621, 628, 631
BstV2I	GAAGAC	1 cut(s)	518
BstX2I	RGATCY	1 cut(s)	934
BstYI	RGATCY	1 cut(s)	934
BsuRI	GGCC	1 cut(s)	192
BtsCI	GGATG	3 cut(s)	268, 291, 412
BtsI	GCAGTG	1 cut(s)	95
BtsIMutI	CAGTG	5 cut(s)	47, 95, 485, 760, 862
CaiI	CAGNNNCTG	1 cut(s)	255
Cfr13I	GGNCC	3 cut(s)	190, 400, 505
Csp6I	GTAC	2 cut(s)	748, 860
CviAII	CATG	2 cut(s)	259, 784
CviQI	GTAC	2 cut(s)	748, 860
DdeI	CTNAG	3 cut(s)	206, 705, 822
DpnI	GATC	3 cut(s)	77, 146, 936
DpnII	GATC	3 cut(s)	75, 144, 934
Eam1104I	CTCTTC	1 cut(s)	416
EarI	CTCTTC	1 cut(s)	416
Ecl136II	GAGCTC	2 cut(s)	214, 687
Eco24I	GRGCYC	2 cut(s)	216, 689
Eco32I	GATATC	1 cut(s)	109
Eco47I	GGWCC	2 cut(s)	400, 505
Eco53kI	GAGCTC	2 cut(s)	214, 687
EcoICRI	GAGCTC	2 cut(s)	214, 687
EcoO109I	RGGNCCY	1 cut(s)	190
EcoRII	CCWGG	1 cut(s)	402
EcoRV	GATATC	1 cut(s)	109
EcoT38I	GRGCYC	2 cut(s)	216, 689
FaeI	CATG	2 cut(s)	262, 787
FaiI	YATR	9 cut(s)	41, 260, 329, 333, 447, 785, 885, 917, 948
FalI	AAGNNNNNCTT	2 cut(s)	890, 922
FaqI	GGGAC	1 cut(s)	491
FatI	CATG	2 cut(s)	258, 783
FauI	CCCGC	2 cut(s)	385, 869
Fnu4HI	GCNGC	6 cut(s)	256, 560, 617, 620, 635, 725
FokI	GGATG	3 cut(s)	275, 278, 419
FriOI	GRGCYC	2 cut(s)	216, 689
Fsp4HI	GCNGC	6 cut(s)	256, 560, 617, 620, 635, 725
FspBI	CTAG	1 cut(s)	194
GluI	GCNGC	6 cut(s)	256, 560, 617, 620, 635, 725
GsuI	CTGGAG	1 cut(s)	402
HaeIII	GGCC	1 cut(s)	192
Hin1II	CATG	2 cut(s)	262, 787
HinfI	GANTC	1 cut(s)	832
Hpy166II	GTNNAC	1 cut(s)	860
Hpy188I	TCNGA	7 cut(s)	207, 230, 251, 303, 626, 684, 823
Hpy188III	TCNNGA	4 cut(s)	73, 112, 373, 508
Hpy8I	GTNNAC	1 cut(s)	860
HpyAV	CCTTC	3 cut(s)	37, 181, 892
HpyCH4III	ACNGT	4 cut(s)	223, 314, 678, 813
HpyCH4V	TGCA	4 cut(s)	258, 415, 522, 865
HpyF3I	CTNAG	3 cut(s)	206, 705, 822
Hsp92II	CATG	2 cut(s)	262, 787
Kzo9I	GATC	3 cut(s)	75, 144, 934
LmnI	GCTCC	2 cut(s)	211, 701
Lsp1109I	GCAGC	4 cut(s)	242, 621, 628, 631
LweI	GCATC	2 cut(s)	253, 402
MaeI	CTAG	1 cut(s)	194
MalI	GATC	3 cut(s)	77, 146, 936
MboI	GATC	3 cut(s)	75, 144, 934
MboII	GAAGA	6 cut(s)	430, 433, 523, 560, 595, 902
MfeI	CAATTG	1 cut(s)	132
MflI	RGATCY	1 cut(s)	934
MhlI	GDGCHC	3 cut(s)	216, 689, 774
MluCI	AATT	7 cut(s)	8, 132, 161, 320, 334, 587, 690
MlyI	GAGTC	1 cut(s)	826
MmeI	TCCRAC	1 cut(s)	510
MroXI	GAANNNNTTC	1 cut(s)	473
MseI	TTAA	3 cut(s)	435, 639, 720
MslI	CAYNNNNRTG	1 cut(s)	855
MspCI	CTTAAG	2 cut(s)	434, 638
MspR9I	CCNGG	1 cut(s)	404
MunI	CAATTG	1 cut(s)	132
Mva1269I	GAATGC	1 cut(s)	908
MvaI	CCWGG	1 cut(s)	404
NdeII	GATC	3 cut(s)	75, 144, 934
NlaIII	CATG	2 cut(s)	262, 787
NlaIV	GGNNCC	1 cut(s)	507
NmeAIII	GCCGAG	1 cut(s)	332
OliI	CACNNNNGTG	1 cut(s)	855
PctI	GAATGC	1 cut(s)	908
PdmI	GAANNNNTTC	1 cut(s)	473
PflFI	GACNNNGTC	1 cut(s)	314
PflMI	CCANNNNNTGG	2 cut(s)	273, 766
PkrI	GCNGC	6 cut(s)	257, 561, 618, 621, 636, 726
PleI	GAGTC	1 cut(s)	826
PpsI	GAGTC	1 cut(s)	826
Psp124BI	GAGCTC	2 cut(s)	216, 689
Psp6I	CCWGG	1 cut(s)	402
PspGI	CCWGG	1 cut(s)	402
PspN4I	GGNNCC	1 cut(s)	507
PspPI	GGNCC	3 cut(s)	190, 400, 505
PstNI	CAGNNNCTG	1 cut(s)	255
PsuI	RGATCY	1 cut(s)	934
PsyI	GACNNNGTC	1 cut(s)	314
RsaI	GTAC	2 cut(s)	749, 861
RsaNI	GTAC	2 cut(s)	748, 860
RseI	CAYNNNNRTG	1 cut(s)	855
SacI	GAGCTC	2 cut(s)	216, 689
SaqAI	TTAA	3 cut(s)	435, 639, 720
SatI	GCNGC	6 cut(s)	256, 560, 617, 620, 635, 725
Sau3AI	GATC	3 cut(s)	75, 144, 934
Sau96I	GGNCC	3 cut(s)	190, 400, 505
SchI	GAGTC	1 cut(s)	826
ScrFI	CCNGG	1 cut(s)	404
SduI	GDGCHC	3 cut(s)	216, 689, 774
SfaNI	GCATC	2 cut(s)	253, 402
SinI	GGWCC	2 cut(s)	400, 505
SmiMI	CAYNNNNRTG	1 cut(s)	855
SmlI	CTYRAG	3 cut(s)	434, 575, 638
SmoI	CTYRAG	3 cut(s)	434, 575, 638
Sse9I	AATT	7 cut(s)	8, 132, 161, 320, 334, 587, 690
SsiI	CCGC	5 cut(s)	392, 559, 724, 727, 876
SspMI	CTAG	1 cut(s)	194
SstI	GAGCTC	2 cut(s)	216, 689
StyD4I	CCNGG	1 cut(s)	402
TaaI	ACNGT	4 cut(s)	223, 314, 678, 813
TaqI	TCGA	3 cut(s)	318, 372, 830
TasI	AATT	7 cut(s)	8, 132, 161, 320, 334, 587, 690
TatI	WGTACW	2 cut(s)	747, 859
TauI	GCSGC	2 cut(s)	562, 727
Tru1I	TTAA	3 cut(s)	435, 639, 720
Tru9I	TTAA	3 cut(s)	435, 639, 720
TscAI	CASTG	5 cut(s)	54, 95, 485, 767, 862
TseI	GCWGC	4 cut(s)	255, 616, 619, 634
TspDTI	ATGAA	3 cut(s)	56, 213, 903
TspRI	CASTG	5 cut(s)	54, 95, 485, 767, 862
Tth111I	GACNNNGTC	1 cut(s)	314
Van91I	CCANNNNNTGG	2 cut(s)	273, 766
Vha464I	CTTAAG	2 cut(s)	434, 638
VpaK11BI	GGWCC	2 cut(s)	400, 505
XapI	RAATTY	1 cut(s)	320
XcmI	CCANNNNNNNNNTGG	1 cut(s)	485
XmnI	GAANNNNTTC	1 cut(s)	473
XspI	CTAG	1 cut(s)	194

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.