Rmu_sc0007727.1_g000034

Belongs to the CRISP family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007727.1
OG0017048
Physical Location & Seq
Forward (+)
163462 .. 165188
1727 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007727.1_g000034.1.cds

Sequence Viewer

Length: 783 bp
atgcccacattgtactgcttcaccatcacaatttctcttctccttatctcaaccacatatgcatattctgcgccctcaaagcaaacgcagcagtacctaagccttgcatacaagttcttggctcctcaaaatgctgctcggtctaccgtccgaatgaggcccttggtgtgggatgcaaagcttgctaggtatgcacagtggtacggcaaccagaggcgatacgactgcgctttgaggcactccaacgggccttacggcgagaatatattctggggtagcggcaaggggtggacgccggctcaggcggtgacggcttgggtttcggaacggaagtggtacagttactggtcaaattcttgtgccagaggacaggaatgcgggcattatacgcagattgtgtggaggagtacaggaagagttgggtgcgctagagttgattgttttggtgggaggggtgtgttcatggttgactacgtactaattgatacagcattcttaccaaatcaaactcatggcggagttggaggggcgttgcgagactctacagggcagtttaaagctgcttttgctcatccaattctacgtgcagcatccccaaagcagtgtgaacttcttacggttcgagaggtttggatttactgtattcacttcaggtacaaaatgtcatccttgaaagtaattgtacagaagctatttctgaagctttatacacagtatgaactcgtagcaaatgcaggtcttattgatgatatcaagcatgctttgaggagaatagaggattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CAP

Protein Analysis

260

Amino Acids

29.64

Weight (kDa)

9.56

Isoelectric Point (pI)

35.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017048)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G30320
fragaria_vesca FvH4_4g09950
malus_domestica MD16G1266300.v1.1
prunus_persica Prupe.1G091300_v2.0.a1
rosa_chinensis RchiOBHm_Chr4g0403501
rosa_laevigata RLG00000008972
rosa_multiflora Rmu_sc0007727.1_g000034
rosa_rugosa Rorug04G0043800
rosa_samantha Rh4AG119200 Rh4BG112300 Rh4CG127000 Rh4DG111900
rosa_wichuraiana Rw4G009670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 725
AccI GTMKAC 1 cut(s) 143
AciI CCGC 4 cut(s) 279, 305, 378, 516
AcsI RAATTY 1 cut(s) 352
AcuI CTGAAG 2 cut(s) 634, 719
AcyI GRCGYC 1 cut(s) 293
AfaI GTAC 8 cut(s) 14, 95, 203, 338, 409, 477, 656, 684
AfiI CCNNNNNNNGG 1 cut(s) 168
AgsI TTSAA 1 cut(s) 673
AluBI AGCT 4 cut(s) 181, 560, 691, 703
AluI AGCT 4 cut(s) 181, 560, 691, 703
Alw26I GTCTC 1 cut(s) 531
AlwNI CAGNNNCTG 1 cut(s) 345
AoxI GGCC 2 cut(s) 158, 248
ApeKI GCWGC 4 cut(s) 88, 134, 560, 587
ApoI RAATTY 1 cut(s) 352
Asp700I GAANNNNTTC 1 cut(s) 266
AspLEI GCGC 3 cut(s) 73, 230, 428
AspS9I GGNCC 2 cut(s) 159, 248
AsuHPI GGTGA 2 cut(s) 13, 319
BbvI GCAGC 4 cut(s) 100, 121, 547, 599
BccI CCATC 1 cut(s) 32
BceAI ACGGC 3 cut(s) 220, 271, 327
BcgI CGANNNNNNTGC 2 cut(s) 207, 241
BcoDI GTCTC 1 cut(s) 531
BfaI CTAG 2 cut(s) 186, 429
BfmI CTRYAG 1 cut(s) 543
BfuAI ACCTGC 1 cut(s) 725
BisI GCNGC 5 cut(s) 89, 135, 280, 561, 588
BlsI GCNGC 5 cut(s) 90, 136, 281, 562, 589
BmgT120I GGNCC 2 cut(s) 159, 248
BmiI GGNNCC 1 cut(s) 123
BmsI GCATC 2 cut(s) 163, 599
Bpu10I CCTNAGC 2 cut(s) 98, 300
BsaAI YACGTR 2 cut(s) 475, 584
BsaHI GRCGYC 1 cut(s) 293
BsaJI CCNNGG 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 168
Bse118I RCCGGY 1 cut(s) 295
Bse1I ACTGG 1 cut(s) 350
BseDI CCNNGG 1 cut(s) 162
BseGI GGATG 4 cut(s) 178, 571, 590, 665
BseLI CCNNNNNNNGG 1 cut(s) 168
BseMII CTCAG 1 cut(s) 314
BseNI ACTGG 1 cut(s) 350
BseRI GAGGAG 3 cut(s) 114, 418, 781
BseXI GCAGC 4 cut(s) 100, 121, 547, 599
BsgI GTGCAG 1 cut(s) 606
BshFI GGCC 2 cut(s) 160, 250
BsiSI CCGG 1 cut(s) 296
BslI CCNNNNNNNGG 1 cut(s) 168
BsmAI GTCTC 1 cut(s) 531
BsmI GAATGC 2 cut(s) 380, 491
BsnI GGCC 2 cut(s) 160, 250
Bsp1407I TGTACA 1 cut(s) 682
BspACI CCGC 4 cut(s) 279, 305, 378, 516
BspANI GGCC 2 cut(s) 160, 250
BspCNI CTCAG 1 cut(s) 313
BspLI GGNNCC 1 cut(s) 123
BspMI ACCTGC 1 cut(s) 725
BsrFI RCCGGY 1 cut(s) 295
BsrGI TGTACA 1 cut(s) 682
BsrI ACTGG 1 cut(s) 350
BssAI RCCGGY 1 cut(s) 295
BssECI CCNNGG 1 cut(s) 162
BssNI GRCGYC 1 cut(s) 293
BssT1I CCWWGG 1 cut(s) 162
Bst4CI ACNGT 6 cut(s) 148, 198, 341, 619, 641, 714
Bst6I CTCTTC 2 cut(s) 42, 409
BstACI GRCGYC 1 cut(s) 293
BstAPI GCANNNNNTGC 2 cut(s) 68, 182
BstAUI TGTACA 1 cut(s) 682
BstBAI YACGTR 2 cut(s) 475, 584
BstC8I GCNNGC 4 cut(s) 183, 297, 380, 759
BstDEI CTNAG 2 cut(s) 98, 300
BstF5I GGATG 4 cut(s) 178, 571, 590, 665
BstHHI GCGC 3 cut(s) 73, 230, 428
BstMAI GTCTC 1 cut(s) 531
BstMWI GCNNNNNNNGC 8 cut(s) 68, 79, 88, 182, 191, 311, 388, 566
BstNSI RCATGY 1 cut(s) 761
BstSFI CTRYAG 1 cut(s) 543
BstSNI TACGTA 1 cut(s) 475
BstV1I GCAGC 4 cut(s) 100, 121, 547, 599
BsuRI GGCC 2 cut(s) 160, 250
BtsCI GGATG 4 cut(s) 178, 571, 590, 665
BtsI GCAGTG 1 cut(s) 608
BtsIMutI CAGTG 2 cut(s) 203, 608
BveI ACCTGC 1 cut(s) 725
Cac8I GCNNGC 4 cut(s) 183, 297, 380, 759
CaiI CAGNNNCTG 1 cut(s) 345
CfoI GCGC 3 cut(s) 73, 230, 428
Cfr10I RCCGGY 1 cut(s) 295
Cfr13I GGNCC 2 cut(s) 159, 248
CseI GACGC 1 cut(s) 301
Csp6I GTAC 8 cut(s) 13, 94, 202, 337, 408, 476, 655, 683
CviAII CATG 3 cut(s) 463, 512, 758
CviQI GTAC 8 cut(s) 13, 94, 202, 337, 408, 476, 655, 683
DdeI CTNAG 2 cut(s) 98, 300
DraI TTTAAA 1 cut(s) 556
Eam1104I CTCTTC 2 cut(s) 42, 409
EarI CTCTTC 2 cut(s) 42, 409
EciI GGCGGA 1 cut(s) 531
Eco105I TACGTA 1 cut(s) 475
Eco130I CCWWGG 1 cut(s) 162
Eco32I GATATC 1 cut(s) 751
Eco57I CTGAAG 2 cut(s) 634, 719
EcoO109I RGGNCCY 1 cut(s) 159
EcoRV GATATC 1 cut(s) 751
EcoT14I CCWWGG 1 cut(s) 162
EcoT22I ATGCAT 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 162
FaeI CATG 3 cut(s) 466, 515, 761
FatI CATG 3 cut(s) 462, 511, 757
FauI CCCGC 1 cut(s) 371
FauNDI CATATG 1 cut(s) 58
FblI GTMKAC 1 cut(s) 143
Fnu4HI GCNGC 5 cut(s) 89, 135, 280, 561, 588
FokI GGATG 4 cut(s) 185, 558, 577, 652
Fsp4HI GCNGC 5 cut(s) 89, 135, 280, 561, 588
FspBI CTAG 2 cut(s) 186, 429
GlaI GCGC 3 cut(s) 72, 229, 427
GluI GCNGC 5 cut(s) 89, 135, 280, 561, 588
HaeIII GGCC 2 cut(s) 160, 250
HapII CCGG 1 cut(s) 296
HgaI GACGC 1 cut(s) 301
HhaI GCGC 3 cut(s) 73, 230, 428
Hin1I GRCGYC 1 cut(s) 293
Hin1II CATG 3 cut(s) 466, 515, 761
Hin6I GCGC 3 cut(s) 71, 228, 426
HinP1I GCGC 3 cut(s) 71, 228, 426
HincII GTYRAC 1 cut(s) 469
HindII GTYRAC 1 cut(s) 469
HindIII AAGCTT 2 cut(s) 179, 701
HinfI GANTC 1 cut(s) 539
HpaII CCGG 1 cut(s) 296
HphI GGTGA 2 cut(s) 13, 319
Hpy166II GTNNAC 4 cut(s) 144, 291, 469, 608
Hpy188I TCNGA 3 cut(s) 152, 325, 699
Hpy188III TCNNGA 1 cut(s) 623
Hpy8I GTNNAC 4 cut(s) 144, 291, 469, 608
HpyCH4III ACNGT 6 cut(s) 148, 198, 341, 619, 641, 714
HpyCH4IV ACGT 2 cut(s) 474, 583
HpyCH4V TGCA 6 cut(s) 62, 107, 176, 194, 587, 734
HpyF10VI GCNNNNNNNGC 8 cut(s) 68, 79, 88, 182, 191, 311, 388, 566
HpyF3I CTNAG 2 cut(s) 98, 300
HpySE526I ACGT 2 cut(s) 474, 583
Hsp92I GRCGYC 1 cut(s) 293
Hsp92II CATG 3 cut(s) 466, 515, 761
HspAI GCGC 3 cut(s) 71, 228, 426
KroI GCCGGC 1 cut(s) 295
KroNI GCCGGC 1 cut(s) 297
LmnI GCTCC 1 cut(s) 127
Lsp1109I GCAGC 4 cut(s) 100, 121, 547, 599
LweI GCATC 2 cut(s) 163, 599
MaeI CTAG 2 cut(s) 186, 429
MaeII ACGT 2 cut(s) 474, 583
MaeIII GTNAC 2 cut(s) 307, 341
MboII GAAGA 2 cut(s) 29, 426
MluCI AATT 5 cut(s) 30, 352, 480, 576, 678
MlyI GAGTC 1 cut(s) 533
MmeI TCCRAC 2 cut(s) 267, 502
Mph1103I ATGCAT 1 cut(s) 64
MroNI GCCGGC 1 cut(s) 295
MroXI GAANNNNTTC 1 cut(s) 266
MseI TTAA 1 cut(s) 555
MspI CCGG 1 cut(s) 296
Mva1269I GAATGC 2 cut(s) 380, 491
MwoI GCNNNNNNNGC 8 cut(s) 68, 79, 88, 182, 191, 311, 388, 566
NaeI GCCGGC 1 cut(s) 297
NdeI CATATG 1 cut(s) 58
NgoMIV GCCGGC 1 cut(s) 295
NlaIII CATG 3 cut(s) 466, 515, 761
NlaIV GGNNCC 1 cut(s) 123
NmuCI GTSAC 1 cut(s) 307
NsiI ATGCAT 1 cut(s) 64
NspI RCATGY 1 cut(s) 761
PaeI GCATGC 1 cut(s) 761
PctI GAATGC 2 cut(s) 380, 491
PdiI GCCGGC 1 cut(s) 297
PdmI GAANNNNTTC 1 cut(s) 266
PkrI GCNGC 5 cut(s) 90, 136, 281, 562, 589
PleI GAGTC 1 cut(s) 533
PpsI GAGTC 1 cut(s) 533
Ppu21I YACGTR 2 cut(s) 475, 584
PspN4I GGNNCC 1 cut(s) 123
PspPI GGNCC 2 cut(s) 159, 248
PstNI CAGNNNCTG 1 cut(s) 345
RsaI GTAC 8 cut(s) 14, 95, 203, 338, 409, 477, 656, 684
RsaNI GTAC 8 cut(s) 13, 94, 202, 337, 408, 476, 655, 683
SaqAI TTAA 1 cut(s) 555
SatI GCNGC 5 cut(s) 89, 135, 280, 561, 588
Sau96I GGNCC 2 cut(s) 159, 248
SchI GAGTC 1 cut(s) 533
SfaNI GCATC 2 cut(s) 163, 599
SfcI CTRYAG 1 cut(s) 543
SnaBI TACGTA 1 cut(s) 475
SphI GCATGC 1 cut(s) 761
Sse9I AATT 5 cut(s) 30, 352, 480, 576, 678
SsiI CCGC 4 cut(s) 279, 305, 378, 516
SspMI CTAG 2 cut(s) 186, 429
StyI CCWWGG 1 cut(s) 162
TaaI ACNGT 6 cut(s) 148, 198, 341, 619, 641, 714
TaiI ACGT 2 cut(s) 477, 586
TaqI TCGA 1 cut(s) 622
TaqII GACCGA 1 cut(s) 129
TasI AATT 5 cut(s) 30, 352, 480, 576, 678
TatI WGTACW 3 cut(s) 12, 407, 682
TauI GCSGC 1 cut(s) 282
Tru1I TTAA 1 cut(s) 555
Tru9I TTAA 1 cut(s) 555
TscAI CASTG 2 cut(s) 203, 608
TseFI GTSAC 1 cut(s) 307
TseI GCWGC 4 cut(s) 88, 134, 560, 587
Tsp45I GTSAC 1 cut(s) 307
TspDTI ATGAA 2 cut(s) 451, 732
TspGWI ACGGA 1 cut(s) 343
TspRI CASTG 2 cut(s) 203, 608
XapI RAATTY 1 cut(s) 352
XceI RCATGY 1 cut(s) 761
XmiI GTMKAC 1 cut(s) 143
XmnI GAANNNNTTC 1 cut(s) 266
XspI CTAG 2 cut(s) 186, 429
Zsp2I ATGCAT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.