Rmu_sc0009209.1_g000001

N-acetyltransferase 9-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009209.1
OG0011423
Physical Location & Seq
Forward (+)
143 .. 2085
1943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009209.1_g000001.1.cds

Sequence Viewer

Length: 612 bp
atggagaaagagaaggagagtgtgagcttggaaggagggaaagtgatacttgtctcttacatgaaacaacatgttcccaaataccatgagtggatgcaagacccagctctgcttcaagccaccggctctgagcccctcactctcgaccaggaataccagatgcagctcacctggacccaagaccccaacaagcagactttcattgtgttagataagcaattggttgtgggagagttcaaacacggagaggcccatgtggaagccatggtaggtgatgtgaatttatatatgaatgacctggatgatccccaattgggagaggttgaaataatgatagctgaacccaaaagtcgtggtaaaggacatgggaaggaatctgtcttgatgatgatggcatttgcagttttgaatttgggaattcacatgttccgtgttaaaattggagaatcaaatgttgcatctcttagcttgttccagaaattgggatttgaggagacttctcgtagtgaaatcttcaaagaggtgacattggagctaaatgtaacaaaggccaagcatgaggagctgctgcatttgatgggtagcttggttatgcataccaactgtcaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Acetyltransf_3

Protein Analysis

203

Amino Acids

23.0

Weight (kDa)

5.26

Isoelectric Point (pI)

33.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011423)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G04845 AT2G04845 AT2G04845 AT2G04845 AT2G04845
fragaria_vesca FvH4_6g41300 FvH4_6g41300
malus_domestica MD09G1120700.v1.1
prunus_persica Prupe.3G202800_v2.0.a1
pyrus_communis pycom09g04530 pycom17g10360
rosa_chinensis RchiOBHm_Chr2g0156861
rosa_laevigata RLG00000020947
rosa_multiflora Rmu_sc0009209.1_g000001 Rmu_ssc0000286.1_g000025
rosa_roxburghii Rroxscaffold_2G00092650
rosa_rugosa Rorug02G0456700
rosa_samantha Rh2AG522300 Rh2CG507200
rosa_wichuraiana Rw2G043130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 481
AclWI GGATC 1 cut(s) 299
AcsI RAATTY 3 cut(s) 280, 409, 417
AfiI CCNNNNNNNGG 2 cut(s) 314, 481
AflIII ACRYGT 2 cut(s) 70, 423
AgsI TTSAA 5 cut(s) 116, 238, 326, 409, 517
AjnI CCWGG 3 cut(s) 147, 170, 297
AluBI AGCT 8 cut(s) 27, 107, 166, 338, 468, 535, 565, 585
AluI AGCT 8 cut(s) 27, 107, 166, 338, 468, 535, 565, 585
Alw26I GTCTC 2 cut(s) 58, 488
AlwI GGATC 1 cut(s) 299
AoxI GGCC 2 cut(s) 249, 549
ApeKI GCWGC 3 cut(s) 163, 565, 568
ApoI RAATTY 3 cut(s) 280, 409, 417
AspS9I GGNCC 2 cut(s) 174, 250
AsuHPI GGTGA 3 cut(s) 160, 284, 535
AvaII GGWCC 1 cut(s) 174
BanII GRGCYC 1 cut(s) 135
BbvI GCAGC 3 cut(s) 175, 552, 555
BccI CCATC 2 cut(s) 385, 571
BciT130I CCWGG 3 cut(s) 149, 172, 299
BcoDI GTCTC 2 cut(s) 58, 488
BisI GCNGC 3 cut(s) 164, 566, 569
BlsI GCNGC 3 cut(s) 165, 567, 570
Bme1390I CCNGG 3 cut(s) 149, 172, 299
Bme18I GGWCC 1 cut(s) 174
BmgT120I GGNCC 2 cut(s) 174, 250
BmiI GGNNCC 1 cut(s) 176
BmrFI CCNGG 3 cut(s) 149, 172, 299
BmsI GCATC 3 cut(s) 84, 150, 467
BsaJI CCNNGG 1 cut(s) 264
BsaXI ACNNNNNCTCC 2 cut(s) 27, 57
Bsc4I CCNNNNNNNGG 2 cut(s) 314, 481
Bse118I RCCGGY 1 cut(s) 122
BseBI CCWGG 3 cut(s) 149, 172, 299
BseDI CCNNGG 1 cut(s) 264
BseGI GGATG 2 cut(s) 99, 307
BseLI CCNNNNNNNGG 2 cut(s) 314, 481
BseMII CTCAG 1 cut(s) 120
BseRI GAGGAG 2 cut(s) 506, 575
BseXI GCAGC 3 cut(s) 175, 552, 555
BseYI CCCAGC 1 cut(s) 103
BshFI GGCC 2 cut(s) 251, 551
BsiSI CCGG 1 cut(s) 123
BslI CCNNNNNNNGG 2 cut(s) 314, 481
BsmAI GTCTC 2 cut(s) 58, 488
BsnI GGCC 2 cut(s) 251, 551
Bsp1286I GDGCHC 1 cut(s) 135
Bsp143I GATC 1 cut(s) 304
Bsp19I CCATGG 1 cut(s) 264
BspANI GGCC 2 cut(s) 251, 551
BspCNI CTCAG 1 cut(s) 121
BspLI GGNNCC 1 cut(s) 176
BspPI GGATC 1 cut(s) 299
BsrFI RCCGGY 1 cut(s) 122
BssAI RCCGGY 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 264
BssMI GATC 1 cut(s) 304
BssT1I CCWWGG 1 cut(s) 264
Bst2UI CCWGG 3 cut(s) 149, 172, 299
Bst4CI ACNGT 1 cut(s) 605
BstDEI CTNAG 2 cut(s) 129, 464
BstDSI CCRYGG 1 cut(s) 264
BstF5I GGATG 2 cut(s) 99, 307
BstKTI GATC 1 cut(s) 307
BstMAI GTCTC 2 cut(s) 58, 488
BstMBI GATC 1 cut(s) 304
BstMWI GCNNNNNNNGC 1 cut(s) 562
BstNI CCWGG 3 cut(s) 149, 172, 299
BstNSI RCATGY 2 cut(s) 74, 427
BstSCI CCNGG 3 cut(s) 147, 170, 297
BstV1I GCAGC 3 cut(s) 175, 552, 555
BsuRI GGCC 2 cut(s) 251, 551
BtgI CCRYGG 1 cut(s) 264
BtsCI GGATG 2 cut(s) 99, 307
Cfr10I RCCGGY 1 cut(s) 122
Cfr13I GGNCC 2 cut(s) 174, 250
CspCI CAANNNNNGTGG 2 cut(s) 334, 369
CviAII CATG 8 cut(s) 61, 71, 86, 254, 265, 365, 424, 557
DdeI CTNAG 2 cut(s) 129, 464
DpnI GATC 1 cut(s) 306
DpnII GATC 1 cut(s) 304
Eco130I CCWWGG 1 cut(s) 264
Eco24I GRGCYC 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 174
EcoRI GAATTC 1 cut(s) 417
EcoRII CCWGG 3 cut(s) 147, 170, 297
EcoT14I CCWWGG 1 cut(s) 264
EcoT22I ATGCAT 1 cut(s) 597
EcoT38I GRGCYC 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 264
FaeI CATG 8 cut(s) 64, 74, 89, 257, 268, 368, 427, 560
FalI AAGNNNNNCTT 2 cut(s) 33, 65
FatI CATG 8 cut(s) 60, 70, 85, 253, 264, 364, 423, 556
Fnu4HI GCNGC 3 cut(s) 164, 566, 569
FokI GGATG 2 cut(s) 106, 314
FriOI GRGCYC 1 cut(s) 135
Fsp4HI GCNGC 3 cut(s) 164, 566, 569
GluI GCNGC 3 cut(s) 164, 566, 569
GsaI CCCAGC 1 cut(s) 107
HaeIII GGCC 2 cut(s) 251, 551
HapII CCGG 1 cut(s) 123
Hin1II CATG 8 cut(s) 64, 74, 89, 257, 268, 368, 427, 560
HinfI GANTC 2 cut(s) 374, 446
HpaII CCGG 1 cut(s) 123
HphI GGTGA 3 cut(s) 160, 284, 535
Hpy188I TCNGA 1 cut(s) 130
Hpy188III TCNNGA 3 cut(s) 143, 382, 475
HpyAV CCTTC 3 cut(s) 7, 26, 364
HpyCH4III ACNGT 1 cut(s) 605
HpyCH4V TGCA 6 cut(s) 97, 163, 401, 458, 571, 595
HpyF10VI GCNNNNNNNGC 1 cut(s) 562
HpyF3I CTNAG 2 cut(s) 129, 464
Hsp92II CATG 8 cut(s) 64, 74, 89, 257, 268, 368, 427, 560
Kzo9I GATC 1 cut(s) 304
LmnI GCTCC 2 cut(s) 532, 562
Lsp1109I GCAGC 3 cut(s) 175, 552, 555
LweI GCATC 3 cut(s) 84, 150, 467
MaeIII GTNAC 2 cut(s) 523, 541
MalI GATC 1 cut(s) 306
MboI GATC 1 cut(s) 304
MboII GAAGA 1 cut(s) 505
MfeI CAATTG 2 cut(s) 218, 311
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 7 cut(s) 218, 280, 311, 409, 417, 438, 479
MnlI CCTC 7 cut(s) 29, 146, 241, 313, 484, 514, 553
Mph1103I ATGCAT 1 cut(s) 597
MseI TTAA 1 cut(s) 435
MspI CCGG 1 cut(s) 123
MspR9I CCNGG 3 cut(s) 149, 172, 299
MunI CAATTG 2 cut(s) 218, 311
MvaI CCWGG 3 cut(s) 149, 172, 299
MwoI GCNNNNNNNGC 1 cut(s) 562
NcoI CCATGG 1 cut(s) 264
NdeII GATC 1 cut(s) 304
NlaIII CATG 8 cut(s) 64, 74, 89, 257, 268, 368, 427, 560
NlaIV GGNNCC 1 cut(s) 176
NmuCI GTSAC 1 cut(s) 523
NsiI ATGCAT 1 cut(s) 597
NspI RCATGY 2 cut(s) 74, 427
PciI ACATGT 2 cut(s) 70, 423
PfeI GAWTC 2 cut(s) 374, 446
PflMI CCANNNNNTGG 1 cut(s) 481
PkrI GCNGC 3 cut(s) 165, 567, 570
PscI ACATGT 2 cut(s) 70, 423
Psp6I CCWGG 3 cut(s) 147, 170, 297
PspFI CCCAGC 1 cut(s) 103
PspGI CCWGG 3 cut(s) 147, 170, 297
PspN4I GGNNCC 1 cut(s) 176
PspPI GGNCC 2 cut(s) 174, 250
SaqAI TTAA 1 cut(s) 435
SatI GCNGC 3 cut(s) 164, 566, 569
Sau3AI GATC 1 cut(s) 304
Sau96I GGNCC 2 cut(s) 174, 250
ScrFI CCNGG 3 cut(s) 149, 172, 299
SduI GDGCHC 1 cut(s) 135
SfaNI GCATC 3 cut(s) 84, 150, 467
SinI GGWCC 1 cut(s) 174
Sse9I AATT 7 cut(s) 218, 280, 311, 409, 417, 438, 479
StyD4I CCNGG 3 cut(s) 147, 170, 297
StyI CCWWGG 1 cut(s) 264
TaaI ACNGT 1 cut(s) 605
TaqI TCGA 1 cut(s) 144
TasI AATT 7 cut(s) 218, 280, 311, 409, 417, 438, 479
TfiI GAWTC 2 cut(s) 374, 446
Tru1I TTAA 1 cut(s) 435
Tru9I TTAA 1 cut(s) 435
TseFI GTSAC 1 cut(s) 523
TseI GCWGC 3 cut(s) 163, 565, 568
Tsp45I GTSAC 1 cut(s) 523
TspDTI ATGAA 3 cut(s) 77, 190, 305
TspGWI ACGGA 2 cut(s) 258, 419
Van91I CCANNNNNTGG 1 cut(s) 481
VpaK11BI GGWCC 1 cut(s) 174
XapI RAATTY 3 cut(s) 280, 409, 417
XceI RCATGY 2 cut(s) 74, 427
Zsp2I ATGCAT 1 cut(s) 597
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.