Rmu_sc0009236.1_g000011

isoaspartyl peptidase L-asparaginase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009236.1
Physical Location & Seq
Forward (+)
62330 .. 62744
415 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009236.1_g000011.1.cds

Sequence Viewer

Length: 255 bp
atggctaccaaaactctgagctccacctgtttcttgacccttacatttttacttctcttcctggttacagggcaccaagctttgaattctgggccataccctgtggtggtgagcacttggcctttcgtagaggctgtcagagctgcttggagggctgttgataatgggctttctgcagttgatgcagttgttgagggctgttcggcttgtgaggaactcagatgtgatggtacaggtgaaagcttcaatctttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

8.96

Weight (kDa)

4.55

Isoelectric Point (pI)

25.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 85
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 1 cut(s) 106
AgsI TTSAA 2 cut(s) 85, 247
AjnI CCWGG 1 cut(s) 60
AluBI AGCT 4 cut(s) 21, 80, 143, 243
AluI AGCT 4 cut(s) 21, 80, 143, 243
Alw21I GWGCWC 2 cut(s) 23, 116
AoxI GGCC 2 cut(s) 92, 119
ApeKI GCWGC 1 cut(s) 143
ApoI RAATTY 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 92
AsuHPI GGTGA 2 cut(s) 121, 248
BaeGI GKGCMC 1 cut(s) 75
BanI GGYRCC 1 cut(s) 72
BanII GRGCYC 1 cut(s) 23
Bbv12I GWGCWC 2 cut(s) 23, 116
BbvI GCAGC 1 cut(s) 130
BccI CCATC 1 cut(s) 221
BciT130I CCWGG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 174
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
Bme1390I CCNGG 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 92
BmiI GGNNCC 1 cut(s) 74
BmrFI CCNGG 1 cut(s) 62
BmsI GCATC 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 106
BseBI CCWGG 1 cut(s) 62
BseLI CCNNNNNNNGG 1 cut(s) 106
BseMII CTCAG 2 cut(s) 8, 232
BseSI GKGCMC 1 cut(s) 75
BseXI GCAGC 1 cut(s) 130
BshFI GGCC 2 cut(s) 94, 121
BshNI GGYRCC 1 cut(s) 72
BsiHKAI GWGCWC 2 cut(s) 23, 116
BslI CCNNNNNNNGG 1 cut(s) 106
BsnI GGCC 2 cut(s) 94, 121
Bsp1286I GDGCHC 3 cut(s) 23, 75, 116
BspANI GGCC 2 cut(s) 94, 121
BspCNI CTCAG 2 cut(s) 9, 231
BspLI GGNNCC 1 cut(s) 74
BspMAI CTGCAG 1 cut(s) 178
BspT107I GGYRCC 1 cut(s) 72
Bst2UI CCWGG 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 62
BstAPI GCANNNNNTGC 1 cut(s) 182
BstDEI CTNAG 2 cut(s) 17, 218
BstMWI GCNNNNNNNGC 3 cut(s) 140, 152, 182
BstNI CCWGG 1 cut(s) 62
BstSCI CCNGG 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 174
BstSLI GKGCMC 1 cut(s) 75
BstV1I GCAGC 1 cut(s) 130
BsuRI GGCC 2 cut(s) 94, 121
Cfr13I GGNCC 1 cut(s) 92
Csp6I GTAC 1 cut(s) 231
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 2 cut(s) 17, 218
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
Ecl136II GAGCTC 1 cut(s) 21
Eco24I GRGCYC 1 cut(s) 23
Eco53kI GAGCTC 1 cut(s) 21
EcoICRI GAGCTC 1 cut(s) 21
EcoRI GAATTC 1 cut(s) 85
EcoRII CCWGG 1 cut(s) 60
EcoT38I GRGCYC 1 cut(s) 23
FaiI YATR 1 cut(s) 97
Fnu4HI GCNGC 1 cut(s) 144
FriOI GRGCYC 1 cut(s) 23
Fsp4HI GCNGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 144
HaeIII GGCC 2 cut(s) 94, 121
HindIII AAGCTT 2 cut(s) 78, 241
HphI GGTGA 2 cut(s) 121, 248
Hpy188I TCNGA 3 cut(s) 18, 140, 221
Hpy188III TCNNGA 1 cut(s) 34
HpyCH4V TGCA 2 cut(s) 176, 185
HpyF10VI GCNNNNNNNGC 3 cut(s) 140, 152, 182
HpyF3I CTNAG 2 cut(s) 17, 218
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 7 cut(s) 40, 47, 54, 74, 75, 114, 219
Lsp1109I GCAGC 1 cut(s) 130
LweI GCATC 1 cut(s) 172
MaeIII GTNAC 1 cut(s) 64
MboII GAAGA 1 cut(s) 49
MhlI GDGCHC 3 cut(s) 23, 75, 116
MluCI AATT 1 cut(s) 85
MnlI CCTC 4 cut(s) 124, 144, 187, 205
MspR9I CCNGG 1 cut(s) 62
MvaI CCWGG 1 cut(s) 62
MwoI GCNNNNNNNGC 3 cut(s) 140, 152, 182
NlaIV GGNNCC 1 cut(s) 74
PkrI GCNGC 1 cut(s) 145
Psp124BI GAGCTC 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 74
PspPI GGNCC 1 cut(s) 92
PstI CTGCAG 1 cut(s) 178
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
SacI GAGCTC 1 cut(s) 23
SatI GCNGC 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 62
SduI GDGCHC 3 cut(s) 23, 75, 116
SetI ASST 6 cut(s) 23, 29, 82, 145, 238, 245
SfaNI GCATC 1 cut(s) 172
SfcI CTRYAG 1 cut(s) 174
Sse9I AATT 1 cut(s) 85
SstI GAGCTC 1 cut(s) 23
StyD4I CCNGG 1 cut(s) 60
TasI AATT 1 cut(s) 85
TseI GCWGC 1 cut(s) 143
XapI RAATTY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.