Rmu_sc0010162.1_g000006

Belongs to the Casparian strip membrane proteins (CASP) family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010162.1
Physical Location & Seq
Reverse (-)
27685 .. 28869
1185 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010162.1_g000006.1.cds

Sequence Viewer

Length: 558 bp
atgagaggaaactcggatgacaatgctccaaatgtccctcttctgaagctcctagattgctctcttagggtttctgtgattcctcttagtattgcaactatatggttgactgtgaccaaccaccaagacaacactggctatgggaagctggacttcggcaacttcatgggcctcaagtacatggtttgcatcagcaccatttctgctgtatatgcttttgttgctgctgtgtcctcatggatcagatgcttagtctctaaagcttggcttttctttgtctctgaccagatagtagcctacctaatggtcacatctgtggctgcagtgatggagatggtgtttttagcttataaaggtgacagggcagtctcatggagtgaagcttgtgcttcatatggacaattctgcagtagaatgaagttggccttggttctccactctctggccctttgtagcttccttgttttagctgtgatttctgcttatagggtcttcagcatgtatgaggcaccttctgtttctcataaagaggtggagttagaagagaacactacatag
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

20.44

Weight (kDa)

6.27

Isoelectric Point (pI)

18.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013358)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 351
AasI GACNNNNNNGTC 1 cut(s) 365
AccB1I GGYRCC 1 cut(s) 508
AccB7I CCANNNNNTGG 1 cut(s) 442
AclWI GGATC 1 cut(s) 248
AcuI CTGAAG 2 cut(s) 65, 478
AfaI GTAC 1 cut(s) 179
AfiI CCNNNNNNNGG 1 cut(s) 442
AjuI GAANNNNNNNTTGG 2 cut(s) 410, 442
AleI CACNNNNGTG 1 cut(s) 314
AluBI AGCT 7 cut(s) 49, 148, 263, 347, 383, 456, 470
AluI AGCT 7 cut(s) 49, 148, 263, 347, 383, 456, 470
Alw26I GTCTC 3 cut(s) 259, 283, 373
AlwI GGATC 1 cut(s) 248
AoxI GGCC 3 cut(s) 169, 423, 444
ApeKI GCWGC 2 cut(s) 224, 320
AspS9I GGNCC 2 cut(s) 169, 445
AsuHPI GGTGA 1 cut(s) 368
BanI GGYRCC 1 cut(s) 508
BbsI GAAGAC 1 cut(s) 484
BbvI GCAGC 2 cut(s) 211, 307
BccI CCATC 2 cut(s) 322, 328
BcoDI GTCTC 3 cut(s) 259, 283, 373
BfaI CTAG 1 cut(s) 53
BfmI CTRYAG 2 cut(s) 321, 406
BisI GCNGC 2 cut(s) 225, 321
BlsI GCNGC 2 cut(s) 226, 322
BmgT120I GGNCC 2 cut(s) 169, 445
BmiI GGNNCC 1 cut(s) 510
BmsI GCATC 2 cut(s) 198, 236
BpiI GAAGAC 1 cut(s) 484
BpuEI CTTGAG 1 cut(s) 158
BsaJI CCNNGG 1 cut(s) 426
BsaXI ACNNNNNCTCC 2 cut(s) 323, 353
Bsc4I CCNNNNNNNGG 1 cut(s) 442
Bse1I ACTGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 426
BseGI GGATG 1 cut(s) 22
BseLI CCNNNNNNNGG 1 cut(s) 442
BseNI ACTGG 1 cut(s) 139
BseXI GCAGC 2 cut(s) 211, 307
BshFI GGCC 3 cut(s) 171, 425, 446
BshNI GGYRCC 1 cut(s) 508
BslFI GGGAC 1 cut(s) 20
BslI CCNNNNNNNGG 1 cut(s) 442
BsmAI GTCTC 3 cut(s) 259, 283, 373
BsmFI GGGAC 1 cut(s) 20
BsnI GGCC 3 cut(s) 171, 425, 446
Bsp143I GATC 1 cut(s) 240
BspANI GGCC 3 cut(s) 171, 425, 446
BspLI GGNNCC 1 cut(s) 510
BspMAI CTGCAG 2 cut(s) 325, 410
BspPI GGATC 1 cut(s) 248
BspT107I GGYRCC 1 cut(s) 508
BsrI ACTGG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 426
BssMI GATC 1 cut(s) 240
BssT1I CCWWGG 1 cut(s) 426
Bst4CI ACNGT 1 cut(s) 112
Bst6I CTCTTC 2 cut(s) 45, 537
BstDEI CTNAG 3 cut(s) 65, 86, 250
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 243
BstMAI GTCTC 3 cut(s) 259, 283, 373
BstMBI GATC 1 cut(s) 240
BstMWI GCNNNNNNNGC 2 cut(s) 212, 221
BstNSI RCATGY 1 cut(s) 502
BstSFI CTRYAG 2 cut(s) 321, 406
BstV1I GCAGC 2 cut(s) 211, 307
BstV2I GAAGAC 1 cut(s) 484
BsuRI GGCC 3 cut(s) 171, 425, 446
BtsCI GGATG 1 cut(s) 22
BtsI GCAGTG 1 cut(s) 330
BtsIMutI CAGTG 2 cut(s) 132, 330
Cfr13I GGNCC 2 cut(s) 169, 445
Csp6I GTAC 1 cut(s) 178
CviAII CATG 5 cut(s) 166, 181, 237, 372, 499
CviQI GTAC 1 cut(s) 178
DdeI CTNAG 3 cut(s) 65, 86, 250
DpnI GATC 1 cut(s) 242
DpnII GATC 1 cut(s) 240
DrdI GACNNNNNNGTC 1 cut(s) 365
DseDI GACNNNNNNGTC 1 cut(s) 365
Eam1104I CTCTTC 2 cut(s) 45, 537
EarI CTCTTC 2 cut(s) 45, 537
Eco130I CCWWGG 1 cut(s) 426
Eco57I CTGAAG 2 cut(s) 65, 478
EcoT14I CCWWGG 1 cut(s) 426
ErhI CCWWGG 1 cut(s) 426
FaeI CATG 5 cut(s) 169, 184, 240, 375, 502
FalI AAGNNNNNCTT 6 cut(s) 137, 169, 252, 284, 410, 442
FaqI GGGAC 1 cut(s) 20
FatI CATG 5 cut(s) 165, 180, 236, 371, 498
FauNDI CATATG 1 cut(s) 394
Fnu4HI GCNGC 2 cut(s) 225, 321
FokI GGATG 1 cut(s) 29
Fsp4HI GCNGC 2 cut(s) 225, 321
FspBI CTAG 1 cut(s) 53
GluI GCNGC 2 cut(s) 225, 321
HaeIII GGCC 3 cut(s) 171, 425, 446
Hin1II CATG 5 cut(s) 169, 184, 240, 375, 502
HincII GTYRAC 1 cut(s) 108
HindII GTYRAC 1 cut(s) 108
HindIII AAGCTT 2 cut(s) 261, 381
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 368
Hpy166II GTNNAC 1 cut(s) 108
Hpy188I TCNGA 4 cut(s) 16, 45, 245, 283
Hpy8I GTNNAC 1 cut(s) 108
HpyAV CCTTC 1 cut(s) 522
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 4 cut(s) 95, 189, 323, 408
HpyF10VI GCNNNNNNNGC 2 cut(s) 212, 221
HpyF3I CTNAG 3 cut(s) 65, 86, 250
Hsp92II CATG 5 cut(s) 169, 184, 240, 375, 502
Kzo9I GATC 1 cut(s) 240
LmnI GCTCC 2 cut(s) 31, 54
LpnPI CCDG 5 cut(s) 120, 134, 299, 346, 428
Lsp1109I GCAGC 2 cut(s) 211, 307
LweI GCATC 2 cut(s) 198, 236
MaeI CTAG 1 cut(s) 53
MaeIII GTNAC 3 cut(s) 112, 307, 356
MalI GATC 1 cut(s) 242
MboI GATC 1 cut(s) 240
MboII GAAGA 3 cut(s) 32, 484, 554
MluCI AATT 1 cut(s) 401
MnlI CCTC 6 cut(s) 48, 93, 182, 244, 499, 523
MslI CAYNNNNRTG 1 cut(s) 314
MwoI GCNNNNNNNGC 2 cut(s) 212, 221
NdeI CATATG 1 cut(s) 394
NdeII GATC 1 cut(s) 240
NlaIII CATG 5 cut(s) 169, 184, 240, 375, 502
NlaIV GGNNCC 1 cut(s) 510
NmuCI GTSAC 3 cut(s) 112, 307, 356
NspI RCATGY 1 cut(s) 502
OliI CACNNNNGTG 1 cut(s) 314
PfeI GAWTC 1 cut(s) 79
PflMI CCANNNNNTGG 1 cut(s) 442
PkrI GCNGC 2 cut(s) 226, 322
PsiI TTATAA 1 cut(s) 351
PspN4I GGNNCC 1 cut(s) 510
PspPI GGNCC 2 cut(s) 169, 445
PstI CTGCAG 2 cut(s) 325, 410
RsaI GTAC 1 cut(s) 179
RsaNI GTAC 1 cut(s) 178
RseI CAYNNNNRTG 1 cut(s) 314
SatI GCNGC 2 cut(s) 225, 321
Sau3AI GATC 1 cut(s) 240
Sau96I GGNCC 2 cut(s) 169, 445
SfaNI GCATC 2 cut(s) 198, 236
SfcI CTRYAG 2 cut(s) 321, 406
SmiMI CAYNNNNRTG 1 cut(s) 314
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 401
SspMI CTAG 1 cut(s) 53
StyI CCWWGG 1 cut(s) 426
TaaI ACNGT 1 cut(s) 112
TasI AATT 1 cut(s) 401
TatI WGTACW 1 cut(s) 177
TfiI GAWTC 1 cut(s) 79
TscAI CASTG 2 cut(s) 139, 330
TseFI GTSAC 3 cut(s) 112, 307, 356
TseI GCWGC 2 cut(s) 224, 320
Tsp45I GTSAC 3 cut(s) 112, 307, 356
TspDTI ATGAA 3 cut(s) 154, 381, 431
TspRI CASTG 2 cut(s) 139, 330
Van91I CCANNNNNTGG 1 cut(s) 442
XceI RCATGY 1 cut(s) 502
XcmI CCANNNNNNNNNTGG 1 cut(s) 131
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.