Rmu_sc0010162.1_g000010

Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010162.1
OG0014255
Physical Location & Seq
Forward (+)
49863 .. 54037
4175 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010162.1_g000010.1.cds

Sequence Viewer

Length: 549 bp
atgtcgaagtggttggggaggattgctgggctgttcagaagtcggagtatggtcggaaaggacaagaccgggaaccgttacttcaccagaaaagatgaagttgacggcgtcttgaaagagaaaagatgggtggtattcaagggggaggaggacccaacctccgttccagttgaatggatatgttggctcaacgggcagcggaaaaaggctccatcaacagaggaaatgatagaattggaagcaaagcgtgaacgagtccggcaaaatgttactcttctgaagaaagaagaagaggaaagaaaagcaagagaaggcactacacgcaaagtcgtgaatactggtaaagctggaggcccagacttgagaagtttcattcgccaatttcctgggtcctcagaaggtgacgaacacaaggaagaaaccaatgagatggatgaagtgaggacccccaaagagaaagaggcagaaaaagaaaaactttcggagtctacagagcctacaggatctggtcaaacattcaagccagggacatggcagccaccaacatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04714 map04714
Pfam Domains
Protein Families
NDUFA12

Protein Analysis

182

Amino Acids

20.9

Weight (kDa)

8.89

Isoelectric Point (pI)

48.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014255)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G26965 AT4G26965
fragaria_vesca FvH4_3g22870
malus_domestica MD11G1216700.v1.1
prunus_persica Prupe.4G214700_v2.0.a1 Prupe.4G214700_v2.0.a1
pyrus_communis pycom03g15150 pycom11g19080
rosa_chinensis RchiOBHm_Chr5g0040171
rosa_laevigata RLG00000033962
rosa_multiflora Rmu_sc0002908.1_g000018 Rmu_sc0010162.1_g000010
rosa_roxburghii Rroxscaffold_1G00041110
rosa_rugosa Rorug05G0183900
rosa_samantha Rh5CG306900 Rh5DG282200
rosa_wichuraiana Rw5G025280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 488
AciI CCGC 1 cut(s) 199
AclWI GGATC 1 cut(s) 511
AcuI CTGAAG 1 cut(s) 299
AcyI GRCGYC 1 cut(s) 108
AgsI TTSAA 4 cut(s) 115, 139, 173, 520
AjnI CCWGG 2 cut(s) 385, 523
AluBI AGCT 1 cut(s) 347
AluI AGCT 1 cut(s) 347
AlwI GGATC 1 cut(s) 511
AlwNI CAGNNNCTG 1 cut(s) 506
AoxI GGCC 1 cut(s) 352
ApeKI GCWGC 2 cut(s) 196, 535
AspS9I GGNCC 4 cut(s) 151, 353, 390, 444
AsuC2I CCSGG 1 cut(s) 70
AsuHPI GGTGA 2 cut(s) 76, 413
AvaII GGWCC 3 cut(s) 151, 390, 444
BbvI GCAGC 1 cut(s) 208
BccI CCATC 3 cut(s) 120, 220, 424
BceAI ACGGC 1 cut(s) 121
BciT130I CCWGG 2 cut(s) 387, 525
BcnI CCSGG 1 cut(s) 70
BfmI CTRYAG 2 cut(s) 489, 498
BisI GCNGC 2 cut(s) 197, 536
BlsI GCNGC 2 cut(s) 198, 537
Bme1390I CCNGG 3 cut(s) 70, 387, 525
Bme18I GGWCC 3 cut(s) 151, 390, 444
BmgT120I GGNCC 4 cut(s) 151, 353, 390, 444
BmiI GGNNCC 5 cut(s) 74, 153, 210, 391, 446
BmrFI CCNGG 3 cut(s) 70, 387, 525
BpmI CTGGAG 1 cut(s) 369
BpuEI CTTGAG 1 cut(s) 382
BpuMI CCSGG 1 cut(s) 70
BsaHI GRCGYC 1 cut(s) 108
BsaJI CCNNGG 2 cut(s) 386, 524
BsaXI ACNNNNNCTCC 2 cut(s) 143, 173
Bse1I ACTGG 2 cut(s) 167, 343
BseBI CCWGG 2 cut(s) 387, 525
BseDI CCNNGG 2 cut(s) 386, 524
BseGI GGATG 1 cut(s) 439
BseMII CTCAG 1 cut(s) 408
BseNI ACTGG 2 cut(s) 167, 343
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 1 cut(s) 208
BseYI CCCAGC 1 cut(s) 26
BshFI GGCC 1 cut(s) 354
BsiSI CCGG 2 cut(s) 69, 259
BslFI GGGAC 1 cut(s) 541
BsmFI GGGAC 1 cut(s) 541
BsnI GGCC 1 cut(s) 354
Bsp143I GATC 1 cut(s) 503
BspACI CCGC 1 cut(s) 199
BspANI GGCC 1 cut(s) 354
BspCNI CTCAG 1 cut(s) 407
BspLI GGNNCC 5 cut(s) 74, 153, 210, 391, 446
BspPI GGATC 1 cut(s) 511
BsrI ACTGG 2 cut(s) 167, 343
BssECI CCNNGG 2 cut(s) 386, 524
BssMI GATC 1 cut(s) 503
BssNI GRCGYC 1 cut(s) 108
Bst2UI CCWGG 2 cut(s) 387, 525
Bst4CI ACNGT 1 cut(s) 77
Bst6I CTCTTC 2 cut(s) 279, 285
BstACI GRCGYC 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 394
BstF5I GGATG 1 cut(s) 439
BstKTI GATC 1 cut(s) 506
BstMBI GATC 1 cut(s) 503
BstMWI GCNNNNNNNGC 2 cut(s) 193, 321
BstNI CCWGG 2 cut(s) 387, 525
BstSCI CCNGG 3 cut(s) 68, 385, 523
BstSFI CTRYAG 2 cut(s) 489, 498
BstV1I GCAGC 1 cut(s) 208
BstX2I RGATCY 1 cut(s) 503
BstXI CCANNNNNNTGG 4 cut(s) 174, 386, 430, 531
BstYI RGATCY 1 cut(s) 503
BsuRI GGCC 1 cut(s) 354
BtsCI GGATG 1 cut(s) 439
CaiI CAGNNNCTG 1 cut(s) 506
Cfr13I GGNCC 4 cut(s) 151, 353, 390, 444
CseI GACGC 1 cut(s) 97
CviAII CATG 2 cut(s) 531, 546
CviJI RGCY 8 cut(s) 31, 187, 209, 347, 354, 496, 523, 538
CviKI_1 RGCY 8 cut(s) 31, 187, 209, 347, 354, 496, 523, 538
DdeI CTNAG 1 cut(s) 394
DpnI GATC 1 cut(s) 505
DpnII GATC 1 cut(s) 503
Eam1104I CTCTTC 2 cut(s) 279, 285
EarI CTCTTC 2 cut(s) 279, 285
Eco47I GGWCC 3 cut(s) 151, 390, 444
Eco57I CTGAAG 1 cut(s) 299
EcoO109I RGGNCCY 3 cut(s) 151, 390, 444
EcoRII CCWGG 2 cut(s) 385, 523
FaeI CATG 2 cut(s) 534, 549
FaiI YATR 4 cut(s) 50, 181, 532, 547
FalI AAGNNNNNCTT 2 cut(s) 462, 494
FaqI GGGAC 1 cut(s) 541
FatI CATG 2 cut(s) 530, 545
FblI GTMKAC 1 cut(s) 488
Fnu4HI GCNGC 2 cut(s) 197, 536
FokI GGATG 1 cut(s) 446
Fsp4HI GCNGC 2 cut(s) 197, 536
GluI GCNGC 2 cut(s) 197, 536
GsaI CCCAGC 1 cut(s) 30
GsuI CTGGAG 1 cut(s) 369
HaeIII GGCC 1 cut(s) 354
HapII CCGG 2 cut(s) 69, 259
HgaI GACGC 1 cut(s) 97
Hin1I GRCGYC 1 cut(s) 108
Hin1II CATG 2 cut(s) 534, 549
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 2 cut(s) 255, 485
HpaII CCGG 2 cut(s) 69, 259
HphI GGTGA 2 cut(s) 76, 413
Hpy166II GTNNAC 3 cut(s) 103, 251, 489
Hpy188I TCNGA 6 cut(s) 38, 45, 56, 279, 397, 484
Hpy188III TCNNGA 2 cut(s) 112, 331
Hpy8I GTNNAC 3 cut(s) 103, 251, 489
HpyAV CCTTC 2 cut(s) 305, 392
HpyCH4III ACNGT 1 cut(s) 77
HpyF10VI GCNNNNNNNGC 2 cut(s) 193, 321
HpyF3I CTNAG 1 cut(s) 394
Hsp92I GRCGYC 1 cut(s) 108
Hsp92II CATG 2 cut(s) 534, 549
Kzo9I GATC 1 cut(s) 503
LmnI GCTCC 1 cut(s) 214
Lsp1109I GCAGC 1 cut(s) 208
MaeIII GTNAC 3 cut(s) 77, 268, 401
MalI GATC 1 cut(s) 505
MboI GATC 1 cut(s) 503
MboII GAAGA 5 cut(s) 266, 292, 299, 302, 428
MflI RGATCY 1 cut(s) 503
MluCI AATT 2 cut(s) 233, 380
MlyI GAGTC 2 cut(s) 264, 494
MmeI TCCRAC 2 cut(s) 23, 34
MslI CAYNNNNRTG 1 cut(s) 544
MspA1I CMGCKG 1 cut(s) 199
MspI CCGG 2 cut(s) 69, 259
MspR9I CCNGG 3 cut(s) 70, 387, 525
MvaI CCWGG 2 cut(s) 387, 525
MwoI GCNNNNNNNGC 2 cut(s) 193, 321
NciI CCSGG 1 cut(s) 70
NdeII GATC 1 cut(s) 503
NlaIII CATG 2 cut(s) 534, 549
NlaIV GGNNCC 5 cut(s) 74, 153, 210, 391, 446
NmuCI GTSAC 1 cut(s) 401
PflFI GACNNNGTC 1 cut(s) 107
PkrI GCNGC 2 cut(s) 198, 537
PleI GAGTC 2 cut(s) 263, 493
PpsI GAGTC 2 cut(s) 263, 493
PpuMI RGGWCCY 3 cut(s) 151, 390, 444
Psp5II RGGWCCY 3 cut(s) 151, 390, 444
Psp6I CCWGG 2 cut(s) 385, 523
PspFI CCCAGC 1 cut(s) 26
PspGI CCWGG 2 cut(s) 385, 523
PspN4I GGNNCC 5 cut(s) 74, 153, 210, 391, 446
PspPI GGNCC 4 cut(s) 151, 353, 390, 444
PspPPI RGGWCCY 3 cut(s) 151, 390, 444
PstNI CAGNNNCTG 1 cut(s) 506
PsuI RGATCY 1 cut(s) 503
PsyI GACNNNGTC 1 cut(s) 107
RseI CAYNNNNRTG 1 cut(s) 544
SatI GCNGC 2 cut(s) 197, 536
Sau3AI GATC 1 cut(s) 503
Sau96I GGNCC 4 cut(s) 151, 353, 390, 444
SchI GAGTC 2 cut(s) 264, 494
ScrFI CCNGG 3 cut(s) 70, 387, 525
SetI ASST 3 cut(s) 161, 349, 403
SfcI CTRYAG 2 cut(s) 489, 498
SinI GGWCC 3 cut(s) 151, 390, 444
SmiMI CAYNNNNRTG 1 cut(s) 544
SmlI CTYRAG 1 cut(s) 361
SmoI CTYRAG 1 cut(s) 361
Sse9I AATT 2 cut(s) 233, 380
SsiI CCGC 1 cut(s) 199
StyD4I CCNGG 3 cut(s) 68, 385, 523
TaaI ACNGT 1 cut(s) 77
TaqI TCGA 1 cut(s) 5
TasI AATT 2 cut(s) 233, 380
TseFI GTSAC 1 cut(s) 401
TseI GCWGC 2 cut(s) 196, 535
Tsp45I GTSAC 1 cut(s) 401
TspDTI ATGAA 3 cut(s) 111, 361, 450
TspGWI ACGGA 1 cut(s) 151
Tth111I GACNNNGTC 1 cut(s) 107
VpaK11BI GGWCC 3 cut(s) 151, 390, 444
XmiI GTMKAC 1 cut(s) 488
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.