Rmu_sc0010379.1_g000002
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010379.1
Physical Location & Seq
Forward (+)
1139 .. 1598
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010379.1_g000002.1.cds

Sequence Viewer

Length: 339 bp
atgtttgcccatgttccaagtggagatgccattttcttaaagggcatacttcacgattggacggatgaggactgcataaagttgttgaagaattgttacagtgctactccagacgacggaaaagtaatcgttttggaggcagttcttccagttttgccggaaacaagcactactgagaagatcaccacccaactggatgtgcttatgatgactcaatgcccaggagggaaggagaggacccaacaagaattcatggacttggcaactggtgctggattcagtggcatcaaatatgaatgtttcgtcgctaatatatgggtcatggagtttattaagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.45

Weight (kDa)

4.61

Isoelectric Point (pI)

19.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019740)

Species Orthologous Gene IDs
malus_domestica MD10G1029900.v1.1
pyrus_communis pycom01g11380 pycom10g21340
rosa_multiflora Rmu_sc0010379.1_g000002
rosa_roxburghii Rroxscaffold_4G00295260
rosa_samantha Rh1CG320300 Rh1DG336700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 248
AfiI CCNNNNNNNGG 1 cut(s) 116
AgsI TTSAA 1 cut(s) 88
AjnI CCWGG 1 cut(s) 220
ApoI RAATTY 1 cut(s) 248
AspS9I GGNCC 1 cut(s) 237
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 1 cut(s) 237
BarI GAAGNNNNNNTAC 2 cut(s) 80, 112
BciT130I CCWGG 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 222
Bme18I GGWCC 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 237
BmiI GGNNCC 1 cut(s) 239
BmrFI CCNGG 1 cut(s) 222
BmsI GCATC 2 cut(s) 16, 294
BpmI CTGGAG 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 116
Bse1I ACTGG 3 cut(s) 149, 198, 271
BseBI CCWGG 1 cut(s) 222
BseDI CCNNGG 1 cut(s) 220
BseGI GGATG 2 cut(s) 70, 202
BseLI CCNNNNNNNGG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 165
BseNI ACTGG 3 cut(s) 149, 198, 271
BsiSI CCGG 1 cut(s) 158
BslI CCNNNNNNNGG 1 cut(s) 116
Bsp143I GATC 1 cut(s) 180
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 239
BsrI ACTGG 3 cut(s) 149, 198, 271
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 1 cut(s) 180
Bst2UI CCWGG 1 cut(s) 222
Bst4CI ACNGT 1 cut(s) 101
BstAPI GCANNNNNTGC 1 cut(s) 269
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 2 cut(s) 70, 202
BstKTI GATC 1 cut(s) 183
BstMBI GATC 1 cut(s) 180
BstMWI GCNNNNNNNGC 1 cut(s) 269
BstNI CCWGG 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 220
BstXI CCANNNNNNTGG 1 cut(s) 193
BtsCI GGATG 2 cut(s) 70, 202
BtsIMutI CAGTG 2 cut(s) 106, 286
Cfr13I GGNCC 1 cut(s) 237
CviAII CATG 3 cut(s) 11, 253, 322
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 182
DpnII GATC 1 cut(s) 180
Eco47I GGWCC 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 237
EcoRI GAATTC 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 220
FaeI CATG 3 cut(s) 14, 256, 325
FaiI YATR 9 cut(s) 12, 47, 77, 206, 254, 294, 314, 316, 323
FatI CATG 3 cut(s) 10, 252, 321
FokI GGATG 2 cut(s) 77, 209
GsuI CTGGAG 1 cut(s) 93
HapII CCGG 1 cut(s) 158
Hin1II CATG 3 cut(s) 14, 256, 325
HinfI GANTC 2 cut(s) 211, 276
HpaII CCGG 1 cut(s) 158
HphI GGTGA 1 cut(s) 175
Hpy188III TCNNGA 2 cut(s) 53, 110
Hpy99I CGWCG 2 cut(s) 119, 308
HpyAV CCTTC 1 cut(s) 223
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4V TGCA 1 cut(s) 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 3 cut(s) 14, 256, 325
Kzo9I GATC 1 cut(s) 180
LpnPI CCDG 8 cut(s) 123, 162, 171, 179, 207, 234, 252, 258
LweI GCATC 2 cut(s) 16, 294
MaeIII GTNAC 1 cut(s) 95
MalI GATC 1 cut(s) 182
MboI GATC 1 cut(s) 180
MboII GAAGA 3 cut(s) 100, 137, 190
MluCI AATT 2 cut(s) 91, 248
MlyI GAGTC 1 cut(s) 205
MnlI CCTC 4 cut(s) 61, 130, 218, 228
MseI TTAA 2 cut(s) 38, 333
MspI CCGG 1 cut(s) 158
MspR9I CCNGG 1 cut(s) 222
MvaI CCWGG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 269
NdeII GATC 1 cut(s) 180
NlaIII CATG 3 cut(s) 14, 256, 325
NlaIV GGNNCC 1 cut(s) 239
PfeI GAWTC 1 cut(s) 276
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PpuMI RGGWCCY 1 cut(s) 237
Psp5II RGGWCCY 1 cut(s) 237
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PspN4I GGNNCC 1 cut(s) 239
PspPI GGNCC 1 cut(s) 237
PspPPI RGGWCCY 1 cut(s) 237
SaqAI TTAA 2 cut(s) 38, 333
Sau3AI GATC 1 cut(s) 180
Sau96I GGNCC 1 cut(s) 237
SchI GAGTC 1 cut(s) 205
ScrFI CCNGG 1 cut(s) 222
SfaNI GCATC 2 cut(s) 16, 294
SinI GGWCC 1 cut(s) 237
Sse9I AATT 2 cut(s) 91, 248
StyD4I CCNGG 1 cut(s) 220
TaaI ACNGT 1 cut(s) 101
TasI AATT 2 cut(s) 91, 248
TfiI GAWTC 1 cut(s) 276
Tru1I TTAA 2 cut(s) 38, 333
Tru9I TTAA 2 cut(s) 38, 333
TscAI CASTG 2 cut(s) 106, 286
TspDTI ATGAA 2 cut(s) 241, 309
TspGWI ACGGA 2 cut(s) 77, 132
TspRI CASTG 2 cut(s) 106, 286
VpaK11BI GGWCC 1 cut(s) 237
XapI RAATTY 1 cut(s) 248
XcmI CCANNNNNNNNNTGG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.