Rmu_sc0015717.1_g000002

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015717.1
Physical Location & Seq
Reverse (-)
2910 .. 3616
707 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015717.1_g000002.1.cds

Sequence Viewer

Length: 516 bp
atgagggtccaaggagttcttcattaccagaacaaccacataacaggaacaaacccaacaccagtcttccccattactccctatcacttctccaaaacccaaatcctaaacacagtgaaccaaaaccacacacaatggcaaaggctaaggatttgtacaatcccagcaacactaggatcaaaatctagtaagagatttccaagcatattagcagcagcagcagctcagccttcacagcctctggacctaacagaagacaacattagacaggtcttggccgatgccagagtcgaatttggtcagctctttgacacttcagttggcatgacaggacaagttgatcttgctgacctagatggaccctttgtgaagatcagtctcaaaggccggttttggcatgaacgcagccttgttctggctaggctggccaattatctcaagcagagaatccctgaaattttggaggtagatatagaagatgagaaacaactggatgacagccccgcaaacttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

171

Amino Acids

19.26

Weight (kDa)

6.51

Isoelectric Point (pI)

46.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011416)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 504
AclWI GGATC 1 cut(s) 184
AcoI YGGCCR 2 cut(s) 276, 426
AcsI RAATTY 2 cut(s) 293, 456
AcuI CTGAAG 1 cut(s) 300
AfaI GTAC 1 cut(s) 157
AfiI CCNNNNNNNGG 1 cut(s) 415
AjuI GAANNNNNNNTTGG 1 cut(s) 35
AluBI AGCT 2 cut(s) 224, 304
AluI AGCT 2 cut(s) 224, 304
Alw26I GTCTC 1 cut(s) 383
AlwI GGATC 1 cut(s) 184
AlwNI CAGNNNCTG 1 cut(s) 241
AoxI GGCC 3 cut(s) 276, 385, 426
ApeKI GCWGC 5 cut(s) 212, 215, 218, 221, 405
ApoI RAATTY 2 cut(s) 293, 456
AspS9I GGNCC 3 cut(s) 7, 244, 359
AvaII GGWCC 3 cut(s) 7, 244, 359
BalI TGGCCA 1 cut(s) 428
BbsI GAAGAC 2 cut(s) 58, 261
BbvI GCAGC 5 cut(s) 224, 227, 230, 233, 417
BccI CCATC 1 cut(s) 350
BcoDI GTCTC 1 cut(s) 383
BfaI CTAG 4 cut(s) 173, 186, 353, 420
BisI GCNGC 5 cut(s) 213, 216, 219, 222, 406
BlpI GCTNAGC 1 cut(s) 225
BlsI GCNGC 5 cut(s) 214, 217, 220, 223, 407
Bme18I GGWCC 3 cut(s) 7, 244, 359
BmgT120I GGNCC 3 cut(s) 7, 244, 359
BmiI GGNNCC 2 cut(s) 8, 361
BmsI GCATC 1 cut(s) 271
BpiI GAAGAC 2 cut(s) 58, 261
Bpu10I CCTNAGC 1 cut(s) 146
Bpu1102I GCTNAGC 1 cut(s) 225
BpuEI CTTGAG 1 cut(s) 422
BsaBI GATNNNNATC 1 cut(s) 181
BsaJI CCNNGG 1 cut(s) 10
Bsc4I CCNNNNNNNGG 1 cut(s) 415
Bse118I RCCGGY 1 cut(s) 387
Bse1I ACTGG 2 cut(s) 62, 495
Bse8I GATNNNNATC 1 cut(s) 181
BseDI CCNNGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 499
BseJI GATNNNNATC 1 cut(s) 181
BseLI CCNNNNNNNGG 1 cut(s) 415
BseMII CTCAG 1 cut(s) 239
BseNI ACTGG 2 cut(s) 62, 495
BseXI GCAGC 5 cut(s) 224, 227, 230, 233, 417
BseYI CCCAGC 1 cut(s) 163
BshFI GGCC 3 cut(s) 278, 387, 428
BsiSI CCGG 1 cut(s) 388
BslI CCNNNNNNNGG 1 cut(s) 415
BsmAI GTCTC 1 cut(s) 383
BsnI GGCC 3 cut(s) 278, 387, 428
Bsp1407I TGTACA 1 cut(s) 155
Bsp143I GATC 3 cut(s) 176, 340, 372
Bsp1720I GCTNAGC 1 cut(s) 225
BspACI CCGC 1 cut(s) 504
BspANI GGCC 3 cut(s) 278, 387, 428
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 2 cut(s) 8, 361
BspPI GGATC 1 cut(s) 184
BsrFI RCCGGY 1 cut(s) 387
BsrGI TGTACA 1 cut(s) 155
BsrI ACTGG 2 cut(s) 62, 495
BssAI RCCGGY 1 cut(s) 387
BssECI CCNNGG 1 cut(s) 10
BssMI GATC 3 cut(s) 176, 340, 372
BssT1I CCWWGG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 115
BstAUI TGTACA 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 426
BstDEI CTNAG 2 cut(s) 146, 225
BstF5I GGATG 1 cut(s) 499
BstKTI GATC 3 cut(s) 179, 343, 375
BstMAI GTCTC 1 cut(s) 383
BstMBI GATC 3 cut(s) 176, 340, 372
BstMWI GCNNNNNNNGC 4 cut(s) 218, 221, 235, 425
BstV1I GCAGC 5 cut(s) 224, 227, 230, 233, 417
BstV2I GAAGAC 2 cut(s) 58, 261
BsuRI GGCC 3 cut(s) 278, 387, 428
BtsCI GGATG 1 cut(s) 499
BtsIMutI CAGTG 1 cut(s) 120
Cac8I GCNNGC 1 cut(s) 426
CaiI CAGNNNCTG 1 cut(s) 241
Cfr10I RCCGGY 1 cut(s) 387
Cfr13I GGNCC 3 cut(s) 7, 244, 359
Csp6I GTAC 1 cut(s) 156
CviAII CATG 2 cut(s) 325, 398
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 2 cut(s) 146, 225
DpnI GATC 3 cut(s) 178, 342, 374
DpnII GATC 3 cut(s) 176, 340, 372
EaeI YGGCCR 2 cut(s) 276, 426
Eco130I CCWWGG 1 cut(s) 10
Eco47I GGWCC 3 cut(s) 7, 244, 359
Eco57I CTGAAG 1 cut(s) 300
EcoT14I CCWWGG 1 cut(s) 10
ErhI CCWWGG 1 cut(s) 10
FaeI CATG 2 cut(s) 328, 401
FaiI YATR 5 cut(s) 41, 206, 326, 399, 473
FalI AAGNNNNNCTT 3 cut(s) 35, 327, 359
FatI CATG 2 cut(s) 324, 397
FauI CCCGC 1 cut(s) 511
Fnu4HI GCNGC 5 cut(s) 213, 216, 219, 222, 406
FokI GGATG 1 cut(s) 506
Fsp4HI GCNGC 5 cut(s) 213, 216, 219, 222, 406
FspBI CTAG 4 cut(s) 173, 186, 353, 420
GluI GCNGC 5 cut(s) 213, 216, 219, 222, 406
GsaI CCCAGC 1 cut(s) 167
HaeIII GGCC 3 cut(s) 278, 387, 428
HapII CCGG 1 cut(s) 388
Hin1II CATG 2 cut(s) 328, 401
HinfI GANTC 2 cut(s) 288, 447
HpaII CCGG 1 cut(s) 388
Hpy166II GTNNAC 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 242
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 240
HpyCH4III ACNGT 1 cut(s) 115
HpyF10VI GCNNNNNNNGC 4 cut(s) 218, 221, 235, 425
HpyF3I CTNAG 2 cut(s) 146, 225
Hsp92II CATG 2 cut(s) 328, 401
Kzo9I GATC 3 cut(s) 176, 340, 372
Lsp1109I GCAGC 5 cut(s) 224, 227, 230, 233, 417
LweI GCATC 1 cut(s) 271
MaeI CTAG 4 cut(s) 173, 186, 353, 420
MalI GATC 3 cut(s) 178, 342, 374
MboI GATC 3 cut(s) 176, 340, 372
MboII GAAGA 5 cut(s) 11, 58, 266, 382, 488
MlsI TGGCCA 1 cut(s) 428
MluCI AATT 3 cut(s) 293, 430, 456
MluNI TGGCCA 1 cut(s) 428
MlyI GAGTC 1 cut(s) 297
MnlI CCTC 2 cut(s) 249, 457
Mox20I TGGCCA 1 cut(s) 428
MscI TGGCCA 1 cut(s) 428
Msp20I TGGCCA 1 cut(s) 428
MspI CCGG 1 cut(s) 388
MwoI GCNNNNNNNGC 4 cut(s) 218, 221, 235, 425
NdeII GATC 3 cut(s) 176, 340, 372
NlaIII CATG 2 cut(s) 328, 401
NlaIV GGNNCC 2 cut(s) 8, 361
PfeI GAWTC 1 cut(s) 447
PkrI GCNGC 5 cut(s) 214, 217, 220, 223, 407
PleI GAGTC 1 cut(s) 296
PpsI GAGTC 1 cut(s) 296
PspFI CCCAGC 1 cut(s) 163
PspN4I GGNNCC 2 cut(s) 8, 361
PspPI GGNCC 3 cut(s) 7, 244, 359
PstNI CAGNNNCTG 1 cut(s) 241
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
SatI GCNGC 5 cut(s) 213, 216, 219, 222, 406
Sau3AI GATC 3 cut(s) 176, 340, 372
Sau96I GGNCC 3 cut(s) 7, 244, 359
SchI GAGTC 1 cut(s) 297
SetI ASST 6 cut(s) 226, 249, 273, 306, 354, 468
SfaNI GCATC 1 cut(s) 271
SinI GGWCC 3 cut(s) 7, 244, 359
SmlI CTYRAG 1 cut(s) 437
SmoI CTYRAG 1 cut(s) 437
Sse9I AATT 3 cut(s) 293, 430, 456
SsiI CCGC 1 cut(s) 504
SspMI CTAG 4 cut(s) 173, 186, 353, 420
StyI CCWWGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 291
TasI AATT 3 cut(s) 293, 430, 456
TatI WGTACW 1 cut(s) 155
TfiI GAWTC 1 cut(s) 447
TscAI CASTG 1 cut(s) 120
TseI GCWGC 5 cut(s) 212, 215, 218, 221, 405
TspDTI ATGAA 2 cut(s) 11, 414
TspRI CASTG 1 cut(s) 120
VpaK11BI GGWCC 3 cut(s) 7, 244, 359
XapI RAATTY 2 cut(s) 293, 456
XspI CTAG 4 cut(s) 173, 186, 353, 420
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.