Rmu_sc0016008.1_g000001

Cyclic phosphodiesterase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016008.1
Physical Location & Seq
Reverse (-)
1144 .. 1485
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016008.1_g000001.1.cds

Sequence Viewer

Length: 342 bp
atgccatcccaagaacaagaagcattggaagcgttcaaggatgcgcaagaaatgcacatgtatgcagtgtgggctcttccaccaacacatgtgctcccacgaatcaagacggtgatggagggcctacgagccgaattcggtggtcctgaaatcgaacctcacatcaccgttttgggatccatgttaaggacggaagaagatacgatccaacaattcaaagatgcttgtaacattatcacccgttttgaatgtaacgtcgatctcattgaaactagtcggtttttttaccagtgtgtctccctcatcattgatccaatcggagatgtagaaccctacatttaa

Protein Analysis

113

Amino Acids

12.94

Weight (kDa)

4.47

Isoelectric Point (pI)

75.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 45
AclWI GGATC 4 cut(s) 171, 184, 199, 305
AcsI RAATTY 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 186
AflIII ACRYGT 2 cut(s) 57, 88
AgsI TTSAA 4 cut(s) 37, 217, 248, 269
AhlI ACTAGT 1 cut(s) 272
Alw21I GWGCWC 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 301
AlwI GGATC 4 cut(s) 171, 184, 199, 305
AoxI GGCC 1 cut(s) 121
ApoI RAATTY 1 cut(s) 134
AspLEI GCGC 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 121, 143
AsuHPI GGTGA 3 cut(s) 124, 157, 229
AvaII GGWCC 1 cut(s) 143
BamHI GGATCC 1 cut(s) 176
BanII GRGCYC 1 cut(s) 76
Bbv12I GWGCWC 1 cut(s) 96
BccI CCATC 2 cut(s) 13, 109
BcoDI GTCTC 1 cut(s) 301
BcuI ACTAGT 1 cut(s) 272
BfaI CTAG 1 cut(s) 273
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 2 cut(s) 121, 143
BmiI GGNNCC 1 cut(s) 178
BmsI GCATC 2 cut(s) 31, 211
BsaXI ACNNNNNCTCC 2 cut(s) 78, 108
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse1I ACTGG 1 cut(s) 289
BseGI GGATG 2 cut(s) 5, 46
BseLI CCNNNNNNNGG 1 cut(s) 186
BseNI ACTGG 1 cut(s) 289
BshFI GGCC 1 cut(s) 123
BsiHKAI GWGCWC 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 186
BsmAI GTCTC 1 cut(s) 301
BsnI GGCC 1 cut(s) 123
Bsp1286I GDGCHC 2 cut(s) 76, 96
Bsp143I GATC 4 cut(s) 176, 204, 259, 310
BspANI GGCC 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 178
BspPI GGATC 4 cut(s) 171, 184, 199, 305
BspQI GCTCTTC 1 cut(s) 81
BsrI ACTGG 1 cut(s) 289
BssMI GATC 4 cut(s) 176, 204, 259, 310
Bst4CI ACNGT 2 cut(s) 112, 169
Bst6I CTCTTC 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 52
BstF5I GGATG 2 cut(s) 5, 46
BstHHI GCGC 1 cut(s) 46
BstKTI GATC 4 cut(s) 179, 207, 262, 313
BstMAI GTCTC 1 cut(s) 301
BstMBI GATC 4 cut(s) 176, 204, 259, 310
BstMWI GCNNNNNNNGC 3 cut(s) 29, 52, 71
BstNSI RCATGY 2 cut(s) 61, 92
BstX2I RGATCY 1 cut(s) 176
BstYI RGATCY 1 cut(s) 176
BsuRI GGCC 1 cut(s) 123
BtsCI GGATG 2 cut(s) 5, 46
BtsI GCAGTG 1 cut(s) 72
BtsIMutI CAGTG 2 cut(s) 72, 296
CfoI GCGC 1 cut(s) 46
Cfr13I GGNCC 2 cut(s) 121, 143
CviAII CATG 3 cut(s) 58, 89, 181
CviJI RGCY 3 cut(s) 74, 123, 131
CviKI_1 RGCY 3 cut(s) 74, 123, 131
DpnI GATC 4 cut(s) 178, 206, 261, 312
DpnII GATC 4 cut(s) 176, 204, 259, 310
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco24I GRGCYC 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 143
EcoO109I RGGNCCY 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 134
EcoT38I GRGCYC 1 cut(s) 76
FaeI CATG 3 cut(s) 61, 92, 184
FaiI YATR 4 cut(s) 59, 63, 90, 182
FatI CATG 3 cut(s) 57, 88, 180
FokI GGATG 1 cut(s) 53
FriOI GRGCYC 1 cut(s) 76
FspBI CTAG 1 cut(s) 273
FspI TGCGCA 1 cut(s) 45
GlaI GCGC 1 cut(s) 45
HaeIII GGCC 1 cut(s) 123
HhaI GCGC 1 cut(s) 46
Hin1II CATG 3 cut(s) 61, 92, 184
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
HinfI GANTC 1 cut(s) 102
HphI GGTGA 3 cut(s) 124, 157, 229
Hpy188I TCNGA 1 cut(s) 320
Hpy188III TCNNGA 2 cut(s) 106, 146
Hpy99I CGWCG 1 cut(s) 260
HpyCH4III ACNGT 2 cut(s) 112, 169
HpyCH4IV ACGT 1 cut(s) 255
HpyCH4V TGCA 2 cut(s) 55, 65
HpyF10VI GCNNNNNNNGC 3 cut(s) 29, 52, 71
HpySE526I ACGT 1 cut(s) 255
Hsp92II CATG 3 cut(s) 61, 92, 184
HspAI GCGC 1 cut(s) 44
Kzo9I GATC 4 cut(s) 176, 204, 259, 310
LguI GCTCTTC 1 cut(s) 81
LmnI GCTCC 1 cut(s) 99
LpnPI CCDG 2 cut(s) 159, 302
LweI GCATC 2 cut(s) 31, 211
MaeI CTAG 1 cut(s) 273
MaeII ACGT 1 cut(s) 255
MaeIII GTNAC 2 cut(s) 227, 251
MalI GATC 4 cut(s) 178, 206, 261, 312
MboI GATC 4 cut(s) 176, 204, 259, 310
MboII GAAGA 3 cut(s) 68, 206, 209
MflI RGATCY 1 cut(s) 176
MhlI GDGCHC 2 cut(s) 76, 96
MluCI AATT 2 cut(s) 134, 212
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 3 cut(s) 112, 168, 311
MseI TTAA 2 cut(s) 185, 340
MslI CAYNNNNRTG 1 cut(s) 60
MwoI GCNNNNNNNGC 3 cut(s) 29, 52, 71
NdeII GATC 4 cut(s) 176, 204, 259, 310
NlaIII CATG 3 cut(s) 61, 92, 184
NlaIV GGNNCC 1 cut(s) 178
NsbI TGCGCA 1 cut(s) 45
NspI RCATGY 2 cut(s) 61, 92
PciI ACATGT 2 cut(s) 57, 88
PciSI GCTCTTC 1 cut(s) 81
PfeI GAWTC 1 cut(s) 102
PscI ACATGT 2 cut(s) 57, 88
PspN4I GGNNCC 1 cut(s) 178
PspPI GGNCC 2 cut(s) 121, 143
PsuI RGATCY 1 cut(s) 176
RseI CAYNNNNRTG 1 cut(s) 60
SapI GCTCTTC 1 cut(s) 81
SaqAI TTAA 2 cut(s) 185, 340
Sau3AI GATC 4 cut(s) 176, 204, 259, 310
Sau96I GGNCC 2 cut(s) 121, 143
SduI GDGCHC 2 cut(s) 76, 96
SetI ASST 2 cut(s) 160, 258
SfaNI GCATC 2 cut(s) 31, 211
SinI GGWCC 1 cut(s) 143
SmiMI CAYNNNNRTG 1 cut(s) 60
SpeI ACTAGT 1 cut(s) 272
Sse9I AATT 2 cut(s) 134, 212
SspMI CTAG 1 cut(s) 273
TaaI ACNGT 2 cut(s) 112, 169
TaiI ACGT 1 cut(s) 258
TaqI TCGA 2 cut(s) 153, 258
TasI AATT 2 cut(s) 134, 212
TfiI GAWTC 1 cut(s) 102
Tru1I TTAA 2 cut(s) 185, 340
Tru9I TTAA 2 cut(s) 185, 340
TscAI CASTG 2 cut(s) 72, 296
TspGWI ACGGA 1 cut(s) 206
TspRI CASTG 2 cut(s) 72, 296
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 1 cut(s) 134
XceI RCATGY 2 cut(s) 61, 92
XspI CTAG 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.