Rmu_sc0018026.1_g000001

Aldo-keto reductase family 4 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0018026.1
Physical Location & Seq
Reverse (-)
1 .. 616
616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0018026.1_g000001.1.cds

Sequence Viewer

Length: 183 bp
atgagtaacgatacagaatctgaaaatctgcattttgatctgaatactggagctaagattccatctgttggccttggaacatggaaagctgaaccgggtgtggtcggtcaagctgtcattgccgcagtgaagaatggctacaggcatattgactgtgcatcagtctatggtaatgaaaaagag

Protein Analysis

61

Amino Acids

6.49

Weight (kDa)

5.17

Isoelectric Point (pI)

17.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0010654)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 68
AciI CCGC 1 cut(s) 123
AfiI CCNNNNNNNGG 1 cut(s) 68
AluBI AGCT 3 cut(s) 53, 89, 113
AluI AGCT 3 cut(s) 53, 89, 113
AlwNI CAGNNNCTG 1 cut(s) 20
AoxI GGCC 1 cut(s) 70
AsuC2I CCSGG 1 cut(s) 96
BarI GAAGNNNNNNTAC 2 cut(s) 122, 154
BccI CCATC 1 cut(s) 70
BcnI CCSGG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 139
BisI GCNGC 1 cut(s) 123
BlsI GCNGC 1 cut(s) 124
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 167
BpmI CTGGAG 1 cut(s) 69
BpuMI CCSGG 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 73
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 1 cut(s) 52
Bse3DI GCAATG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 117
BseNI ACTGG 1 cut(s) 52
BshFI GGCC 1 cut(s) 72
BsiSI CCGG 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 68
BsnI GGCC 1 cut(s) 72
Bsp143I GATC 1 cut(s) 37
BspACI CCGC 1 cut(s) 123
BspANI GGCC 1 cut(s) 72
BsrDI GCAATG 1 cut(s) 117
BsrI ACTGG 1 cut(s) 52
BssECI CCNNGG 1 cut(s) 73
BssMI GATC 1 cut(s) 37
BssT1I CCWWGG 1 cut(s) 73
Bst4CI ACNGT 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 54
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstMWI GCNNNNNNNGC 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 94
BstSFI CTRYAG 1 cut(s) 139
BsuRI GGCC 1 cut(s) 72
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 132
CaiI CAGNNNCTG 1 cut(s) 20
CviAII CATG 1 cut(s) 81
CviJI RGCY 5 cut(s) 53, 72, 89, 113, 138
CviKI_1 RGCY 5 cut(s) 53, 72, 89, 113, 138
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
Eco130I CCWWGG 1 cut(s) 73
EcoT14I CCWWGG 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 73
FaeI CATG 1 cut(s) 84
FaiI YATR 3 cut(s) 82, 147, 168
FatI CATG 1 cut(s) 80
Fnu4HI GCNGC 1 cut(s) 123
Fsp4HI GCNGC 1 cut(s) 123
GluI GCNGC 1 cut(s) 123
GsuI CTGGAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 72
HapII CCGG 1 cut(s) 95
Hin1II CATG 1 cut(s) 84
HinfI GANTC 2 cut(s) 17, 58
HpaII CCGG 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 22, 42
HpyCH4III ACNGT 1 cut(s) 155
HpyCH4V TGCA 2 cut(s) 31, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 119
HpyF3I CTNAG 1 cut(s) 54
Hsp92II CATG 1 cut(s) 84
Kzo9I GATC 1 cut(s) 37
LmnI GCTCC 1 cut(s) 50
LpnPI CCDG 3 cut(s) 33, 108, 127
LweI GCATC 1 cut(s) 167
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 142
MspI CCGG 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 119
NciI CCSGG 1 cut(s) 96
NdeII GATC 1 cut(s) 37
NlaIII CATG 1 cut(s) 84
PfeI GAWTC 2 cut(s) 17, 58
PflMI CCANNNNNTGG 1 cut(s) 68
PkrI GCNGC 1 cut(s) 124
PstNI CAGNNNCTG 1 cut(s) 20
SatI GCNGC 1 cut(s) 123
Sau3AI GATC 1 cut(s) 37
ScrFI CCNGG 1 cut(s) 96
SetI ASST 3 cut(s) 55, 91, 115
SfaNI GCATC 1 cut(s) 167
SfcI CTRYAG 1 cut(s) 139
SgeI CNNG 7 cut(s) 60, 86, 93, 107, 108, 122, 154
SsiI CCGC 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 94
StyI CCWWGG 1 cut(s) 73
TaaI ACNGT 1 cut(s) 155
TaqII GACCGA 1 cut(s) 95
TauI GCSGC 1 cut(s) 125
TfiI GAWTC 2 cut(s) 17, 58
TscAI CASTG 1 cut(s) 132
TspRI CASTG 1 cut(s) 132
Van91I CCANNNNNTGG 1 cut(s) 68
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.