Rmu_sc0021466.1_g000001

3-ketoacyl-CoA synthase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021466.1
OG0019378
Physical Location & Seq
Forward (+)
7 .. 429
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021466.1_g000001.1.cds

Sequence Viewer

Length: 423 bp
atgactcatgctttcacagtgaacctccaagtttttgtgccaaaagtgcttccactaacagaaataatccgatacctggtggcttctaggcttcagaaaaacaacagtaccaaatgccaaaatctagaagcagttggagtcagtttgaatataaaggctggaattcaacacttctgtctccaccctggtggaagagcaattataaatgggataggtaagagcttatcattaagcgactatgatcttgagccatctagaatggcgctttacagatttggtaacacatcagctgctggcttttggtatgctttgggatacatggaagccaaacaaaggcttaagaggggtgataggattctaatgagtgtggctttggagcaggttttaaatgtactaaggccccttgattatgccaatgtctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006950 GO:0008150 GO:0009266 GO:0009314 GO:0009409 GO:0009416 GO:0009628 GO:0050896
KEGG Pathways
Metabolic & Signaling
ko00062 ko01110 map00062 map01110
Pfam Domains
Protein Families
ACP_syn_III_C FAE1_CUT1_RppA

Protein Analysis

140

Amino Acids

15.61

Weight (kDa)

9.69

Isoelectric Point (pI)

39.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019378)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0145521
rosa_multiflora Rmu_sc0002081.1_g000005 Rmu_sc0002835.1_g000015 Rmu_sc0005710.1_g000007 Rmu_sc0021466.1_g000001
rosa_rugosa Rorug01G0320600
rosa_samantha Rh5BG207100 Rh5BG555800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 203
Acc36I ACCTGC 1 cut(s) 370
AcsI RAATTY 1 cut(s) 162
AcuI CTGAAG 1 cut(s) 77
AfaI GTAC 2 cut(s) 109, 393
AfiI CCNNNNNNNGG 2 cut(s) 76, 333
AflII CTTAAG 1 cut(s) 338
AgsI TTSAA 2 cut(s) 148, 167
AjnI CCWGG 2 cut(s) 75, 184
AleI CACNNNNGTG 1 cut(s) 186
AluBI AGCT 2 cut(s) 222, 290
AluI AGCT 2 cut(s) 222, 290
Alw26I GTCTC 1 cut(s) 182
AlwNI CAGNNNCTG 1 cut(s) 293
AoxI GGCC 1 cut(s) 398
ApeKI GCWGC 1 cut(s) 290
ApoI RAATTY 1 cut(s) 162
AspLEI GCGC 1 cut(s) 265
AspS9I GGNCC 1 cut(s) 399
AsuHPI GGTGA 1 cut(s) 359
BaeI ACNNNNGTAYC 2 cut(s) 91, 124
BbvI GCAGC 1 cut(s) 277
BccI CCATC 1 cut(s) 259
BciT130I CCWGG 2 cut(s) 77, 186
BciVI GTATCC 1 cut(s) 308
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 3 cut(s) 87, 125, 255
BfoI RGCGCY 1 cut(s) 266
BfrI CTTAAG 1 cut(s) 338
BfuAI ACCTGC 1 cut(s) 370
BfuI GTATCC 1 cut(s) 308
BisI GCNGC 1 cut(s) 291
BlsI GCNGC 1 cut(s) 292
Bme1390I CCNGG 2 cut(s) 77, 186
BmgT120I GGNCC 1 cut(s) 399
BmiI GGNNCC 1 cut(s) 401
BmrFI CCNGG 2 cut(s) 77, 186
BpuEI CTTGAG 1 cut(s) 266
BsaJI CCNNGG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 333
BseBI CCWGG 2 cut(s) 77, 186
BseDI CCNNGG 1 cut(s) 184
BseLI CCNNNNNNNGG 2 cut(s) 76, 333
BseXI GCAGC 1 cut(s) 277
BshFI GGCC 1 cut(s) 400
BslI CCNNNNNNNGG 2 cut(s) 76, 333
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 1 cut(s) 400
Bsp143I GATC 1 cut(s) 241
BspANI GGCC 1 cut(s) 400
BspLI GGNNCC 1 cut(s) 401
BspMI ACCTGC 1 cut(s) 370
BspQI GCTCTTC 1 cut(s) 187
BspTI CTTAAG 1 cut(s) 338
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 1 cut(s) 241
Bst2UI CCWGG 2 cut(s) 77, 186
Bst4CI ACNGT 2 cut(s) 19, 107
Bst6I CTCTTC 1 cut(s) 187
BstAFI CTTAAG 1 cut(s) 338
BstC8I GCNNGC 1 cut(s) 295
BstDEI CTNAG 1 cut(s) 395
BstH2I RGCGCY 1 cut(s) 266
BstHHI GCGC 1 cut(s) 265
BstKTI GATC 1 cut(s) 244
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 241
BstMWI GCNNNNNNNGC 1 cut(s) 46
BstNI CCWGG 2 cut(s) 77, 186
BstSCI CCNGG 2 cut(s) 75, 184
BstV1I GCAGC 1 cut(s) 277
BstXI CCANNNNNNTGG 1 cut(s) 188
BsuI GTATCC 1 cut(s) 308
BsuRI GGCC 1 cut(s) 400
BtsIMutI CAGTG 1 cut(s) 24
BveI ACCTGC 1 cut(s) 370
Cac8I GCNNGC 1 cut(s) 295
CaiI CAGNNNCTG 1 cut(s) 293
CfoI GCGC 1 cut(s) 265
Cfr13I GGNCC 1 cut(s) 399
CsiI ACCWGGT 1 cut(s) 75
Csp6I GTAC 2 cut(s) 108, 392
CviAII CATG 2 cut(s) 8, 319
CviQI GTAC 2 cut(s) 108, 392
DdeI CTNAG 1 cut(s) 395
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
DraI TTTAAA 1 cut(s) 387
Eam1104I CTCTTC 1 cut(s) 187
EarI CTCTTC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 77
EcoO109I RGGNCCY 1 cut(s) 399
EcoRI GAATTC 1 cut(s) 162
EcoRII CCWGG 2 cut(s) 75, 184
FaeI CATG 2 cut(s) 11, 322
FaiI YATR 7 cut(s) 9, 152, 203, 240, 306, 320, 411
FatI CATG 2 cut(s) 7, 318
Fnu4HI GCNGC 1 cut(s) 291
Fsp4HI GCNGC 1 cut(s) 291
FspBI CTAG 3 cut(s) 87, 125, 255
GlaI GCGC 1 cut(s) 264
GluI GCNGC 1 cut(s) 291
HaeII RGCGCY 1 cut(s) 266
HaeIII GGCC 1 cut(s) 400
HhaI GCGC 1 cut(s) 265
Hin1II CATG 2 cut(s) 11, 322
Hin6I GCGC 1 cut(s) 263
HinP1I GCGC 1 cut(s) 263
HinfI GANTC 3 cut(s) 4, 138, 355
HphI GGTGA 1 cut(s) 359
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 3 cut(s) 71, 96, 422
Hpy188III TCNNGA 3 cut(s) 125, 245, 255
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4III ACNGT 2 cut(s) 19, 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 46
HpyF3I CTNAG 1 cut(s) 395
Hsp92II CATG 2 cut(s) 11, 322
HspAI GCGC 1 cut(s) 263
Kzo9I GATC 1 cut(s) 241
LguI GCTCTTC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 376
LpnPI CCDG 7 cut(s) 62, 89, 144, 171, 198, 279, 365
Lsp1109I GCAGC 1 cut(s) 277
MabI ACCWGGT 1 cut(s) 75
MaeI CTAG 3 cut(s) 87, 125, 255
MaeIII GTNAC 1 cut(s) 278
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 1 cut(s) 204
MluCI AATT 2 cut(s) 162, 198
MlyI GAGTC 1 cut(s) 147
MmeI TCCRAC 1 cut(s) 115
MnlI CCTC 2 cut(s) 35, 336
MseI TTAA 3 cut(s) 230, 339, 386
MslI CAYNNNNRTG 1 cut(s) 186
MspA1I CMGCKG 1 cut(s) 290
MspCI CTTAAG 1 cut(s) 338
MspR9I CCNGG 2 cut(s) 77, 186
MvaI CCWGG 2 cut(s) 77, 186
MwoI GCNNNNNNNGC 1 cut(s) 46
NdeII GATC 1 cut(s) 241
NlaIII CATG 2 cut(s) 11, 322
NlaIV GGNNCC 1 cut(s) 401
OliI CACNNNNGTG 1 cut(s) 186
PciSI GCTCTTC 1 cut(s) 187
PfeI GAWTC 1 cut(s) 355
PkrI GCNGC 1 cut(s) 292
PleI GAGTC 1 cut(s) 146
PpsI GAGTC 1 cut(s) 146
PsiI TTATAA 1 cut(s) 203
Psp6I CCWGG 2 cut(s) 75, 184
PspGI CCWGG 2 cut(s) 75, 184
PspN4I GGNNCC 1 cut(s) 401
PspPI GGNCC 1 cut(s) 399
PstNI CAGNNNCTG 1 cut(s) 293
PvuII CAGCTG 1 cut(s) 290
RsaI GTAC 2 cut(s) 109, 393
RsaNI GTAC 2 cut(s) 108, 392
RseI CAYNNNNRTG 1 cut(s) 186
SapI GCTCTTC 1 cut(s) 187
SaqAI TTAA 3 cut(s) 230, 339, 386
SatI GCNGC 1 cut(s) 291
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 399
SchI GAGTC 1 cut(s) 147
ScrFI CCNGG 2 cut(s) 77, 186
SetI ASST 6 cut(s) 27, 78, 217, 224, 292, 384
SexAI ACCWGGT 1 cut(s) 75
SmiMI CAYNNNNRTG 1 cut(s) 186
SmlI CTYRAG 2 cut(s) 245, 338
SmoI CTYRAG 2 cut(s) 245, 338
Sse9I AATT 2 cut(s) 162, 198
SspMI CTAG 3 cut(s) 87, 125, 255
StyD4I CCNGG 2 cut(s) 75, 184
TaaI ACNGT 2 cut(s) 19, 107
TasI AATT 2 cut(s) 162, 198
TatI WGTACW 1 cut(s) 391
TfiI GAWTC 1 cut(s) 355
Tru1I TTAA 3 cut(s) 230, 339, 386
Tru9I TTAA 3 cut(s) 230, 339, 386
TscAI CASTG 1 cut(s) 24
TseI GCWGC 1 cut(s) 290
TspRI CASTG 1 cut(s) 24
Vha464I CTTAAG 1 cut(s) 338
XapI RAATTY 1 cut(s) 162
XbaI TCTAGA 2 cut(s) 124, 254
XspI CTAG 3 cut(s) 87, 125, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.