Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0022491.1

Orthogroup ID

OG0008715

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 3024

Gene Structure 3024 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0022491.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1495 bp

atgaaattacaatgtgttaccacacccgagaaaggaaagggtttggcttccacggtggacattcctcaagcatccttggtacattccgaagacccttttgcaacgataatattaaagcattgccgggaaacacattgccactactgcttgaatgaactaccagcagataaagtcccatgtacatcatgttcaataccatggtattgctcccagaaatgctgtatagaggcaggaggagaaatgtgctgcgattacccaaacaatcaaagcattcataagtatctaccagacgaccttcagaagtacatcgtggaggccactttaattgctgattctgaaagagataatcagatttctgaacataagcatgagtgtaaaggtgtaccctggccagcagtattgccttctgagatagttttggctggtcgagtactagtcaactctataatcaaaagaggaggttccacagatagtattaatctcggagaaatttcggatctttctcatcattattcaaaaatgcctccggaatcgaaattggaattacatatattctctgctgtattatcatgctgtctgcatcattgtaatggctttgaaataccaataaacgggatctccatttcacagattgttatacttatatcccaaattagggtgaactctatgacagttgttcgtatgaaatacattgaccagcatgaactagcagatcagtttggaaatctgtcatcttgggaaggaggtccaaccagtaatgtggaacaggtcagagtaggtcaagctatctatgcatcaggaagcttgttcaaccattcttgtcgacctaacatccatgcttatttcctttcacgcactcttcatatacgaactacagaatatgtctcagcagggtgtccccttgagttgtcctatggtccacaggttgggcagtgggattgtaaggacaggattaagtttctggaagatgagtactcatttcgatgtcagtgcaccggttgttcaaaaatgaacttttcagacttagtgctaaatgcatttcactgtgtgaagctgaactgttctggcatagtcttggagagctctgttattaactgtgaaaaagagaaacttaagcacttaccgaacatcatcaacactgacagcatcgtctctcttcttcaggctgaagagctcaatattgatgacatcaataaagctgcaaatgaaatgcaaatcaatagcttttaccagttaaatcctggctactgtctaaaatgtggttcttatcgtgatctagaatcttcctctgtagctgcaaataactgtatcagaagattacagaattccatagactcaaaaaatgtctctagtaccatgcttttgggtgctttaagttctcttggtgtgctgagatcaactttgcatgcatataatagaagaattgcagaggcagaagataatcttgcacaagcattttgtttggtcggagagttgcaacctgcaatggagcact

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

SET TPR_8 zf-MYND

Protein Analysis

498

Amino Acids

55.34

Weight (kDa)

5.85

Isoelectric Point (pI)

47.12

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008715)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G33400 AT1G33400 AT1G33400
fragaria_vesca	FvH4_7g26380
malus_domestica	MD07G1239100.v1.1
prunus_persica	Prupe.2G267900_v2.0.a1 Prupe.2G267900_v2.0.a1 Prupe.2G267900_v2.0.a1 Prupe.2G267900_v2.0.a1 Prupe.2G267900_v2.0.a1
pyrus_communis	pycom07g21510
rosa_chinensis	RchiOBHm_Chr1g0372931
rosa_laevigata	RLG00000026865
rosa_multiflora	Rmu_sc0022491.1_g000001 Rmu_sc0026741.1_g000001 Rmu_ssc0000425.1_g000016
rosa_roxburghii	Rroxscaffold_4G00284600
rosa_rugosa	Rorug01G0375000
rosa_samantha	Rh1AG383500 Rh1BG347400 Rh1CG360800 Rh1DG378300
rosa_wichuraiana	Rw1G033790

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1148
Acc36I	ACCTGC	1 cut(s)	1489
AccB7I	CCANNNNNTGG	1 cut(s)	926
AccI	GTMKAC	1 cut(s)	823
AccIII	TCCGGA	1 cut(s)	526
AclWI	GGATC	2 cut(s)	504, 623
AcoI	YGGCCR	1 cut(s)	389
AcsI	RAATTY	2 cut(s)	489, 1324
AcuI	CTGAAG	3 cut(s)	281, 1145, 1188
AdeI	CACNNNGTG	1 cut(s)	1048
AfaI	GTAC	7 cut(s)	81, 181, 305, 384, 432, 974, 1354
AfiI	CCNNNNNNNGG	5 cut(s)	32, 611, 654, 655, 926
AflII	CTTAAG	1 cut(s)	1112
AgeI	ACCGGT	1 cut(s)	995
AgsI	TTSAA	6 cut(s)	151, 192, 516, 599, 811, 1005
AhlI	ACTAGT	1 cut(s)	433
AjnI	CCWGG	2 cut(s)	386, 1240
AluBI	AGCT	8 cut(s)	785, 804, 1054, 1083, 1174, 1199, 1224, 1295
AluI	AGCT	8 cut(s)	785, 804, 1054, 1083, 1174, 1199, 1224, 1295
Alw21I	GWGCWC	4 cut(s)	995, 1085, 1176, 1494
Alw26I	GTCTC	3 cut(s)	889, 1156, 1351
Alw44I	GTGCAC	1 cut(s)	991
AlwI	GGATC	2 cut(s)	504, 623
Ama87I	CYCGRG	1 cut(s)	26
Aor13HI	TCCGGA	1 cut(s)	526
AoxI	GGCC	2 cut(s)	315, 389
ApaLI	GTGCAC	1 cut(s)	991
ApeKI	GCWGC	3 cut(s)	246, 1199, 1295
ApoI	RAATTY	2 cut(s)	489, 1324
AseI	ATTAAT	1 cut(s)	477
AsiGI	ACCGGT	1 cut(s)	995
AspS9I	GGNCC	2 cut(s)	746, 917
AsuC2I	CCSGG	1 cut(s)	125
AsuHPI	GGTGA	1 cut(s)	670
AvaI	CYCGRG	1 cut(s)	26
AvaII	GGWCC	2 cut(s)	746, 917
BaeGI	GKGCMC	1 cut(s)	995
BalI	TGGCCA	1 cut(s)	391
BanII	GRGCYC	2 cut(s)	1085, 1176
BbsI	GAAGAC	1 cut(s)	96
Bbv12I	GWGCWC	4 cut(s)	995, 1085, 1176, 1494
BbvI	GCAGC	3 cut(s)	233, 1186, 1282
BcgI	CGANNNNNNTGC	2 cut(s)	972, 1006
BciT130I	CCWGG	2 cut(s)	388, 1242
BcnI	CCSGG	1 cut(s)	125
BcoDI	GTCTC	3 cut(s)	889, 1156, 1351
BcuI	ACTAGT	1 cut(s)	433
BfaI	CTAG	4 cut(s)	434, 707, 1277, 1350
BfmI	CTRYAG	2 cut(s)	873, 1290
BfrI	CTTAAG	1 cut(s)	1112
BfuAI	ACCTGC	1 cut(s)	1489
BisI	GCNGC	3 cut(s)	247, 1200, 1296
BlsI	GCNGC	3 cut(s)	248, 1201, 1297
BmcAI	AGTACT	2 cut(s)	432, 974
Bme1390I	CCNGG	3 cut(s)	125, 388, 1242
Bme18I	GGWCC	2 cut(s)	746, 917
BmeT110I	CYCGRG	1 cut(s)	26
BmgT120I	GGNCC	2 cut(s)	746, 917
BmiI	GGNNCC	1 cut(s)	463
BmrFI	CCNGG	3 cut(s)	125, 388, 1242
BmsI	GCATC	4 cut(s)	80, 589, 803, 1155
BpiI	GAAGAC	1 cut(s)	96
BpuEI	CTTGAG	2 cut(s)	51, 923
BpuMI	CCSGG	1 cut(s)	125
BsaJI	CCNNGG	4 cut(s)	51, 75, 197, 386
BsaWI	WCCGGW	2 cut(s)	526, 995
BsaXI	ACNNNNNCTCC	2 cut(s)	602, 632
Bsc4I	CCNNNNNNNGG	5 cut(s)	32, 611, 654, 655, 926
Bse118I	RCCGGY	1 cut(s)	995
Bse1I	ACTGG	2 cut(s)	753, 1231
Bse3DI	GCAATG	3 cut(s)	118, 133, 1491
BseAI	TCCGGA	1 cut(s)	526
BseBI	CCWGG	2 cut(s)	388, 1242
BseDI	CCNNGG	4 cut(s)	51, 75, 197, 386
BseGI	GGATG	2 cut(s)	71, 831
BseLI	CCNNNNNNNGG	5 cut(s)	32, 611, 654, 655, 926
BseMI	GCAATG	3 cut(s)	118, 133, 1491
BseMII	CTCAG	3 cut(s)	399, 900, 1382
BseNI	ACTGG	2 cut(s)	753, 1231
BseRI	GAGGAG	2 cut(s)	249, 471
BseSI	GKGCMC	1 cut(s)	995
BseXI	GCAGC	3 cut(s)	233, 1186, 1282
BshFI	GGCC	2 cut(s)	317, 391
BshTI	ACCGGT	1 cut(s)	995
BsiHKAI	GWGCWC	4 cut(s)	995, 1085, 1176, 1494
BsiHKCI	CYCGRG	1 cut(s)	26
BsiSI	CCGG	3 cut(s)	124, 527, 996
BslFI	GGGAC	2 cut(s)	158, 882
BslI	CCNNNNNNNGG	5 cut(s)	32, 611, 654, 655, 926
BsmAI	GTCTC	3 cut(s)	889, 1156, 1351
BsmBI	CGTCTC	1 cut(s)	1156
BsmFI	GGGAC	2 cut(s)	158, 882
BsmI	GAATGC	1 cut(s)	270
BsnI	GGCC	2 cut(s)	317, 391
BsoBI	CYCGRG	1 cut(s)	26
Bsp1286I	GDGCHC	4 cut(s)	995, 1085, 1176, 1494
Bsp13I	TCCGGA	1 cut(s)	526
Bsp1407I	TGTACA	1 cut(s)	179
Bsp143I	GATC	5 cut(s)	496, 615, 712, 1273, 1394
Bsp19I	CCATGG	1 cut(s)	197
BspANI	GGCC	2 cut(s)	317, 391
BspCNI	CTCAG	3 cut(s)	400, 899, 1383
BspEI	TCCGGA	1 cut(s)	526
BspLI	GGNNCC	1 cut(s)	463
BspMI	ACCTGC	1 cut(s)	1489
BspPI	GGATC	2 cut(s)	504, 623
BspQI	GCTCTTC	1 cut(s)	1164
BspTI	CTTAAG	1 cut(s)	1112
BsrDI	GCAATG	3 cut(s)	118, 133, 1491
BsrFI	RCCGGY	1 cut(s)	995
BsrGI	TGTACA	1 cut(s)	179
BsrI	ACTGG	2 cut(s)	753, 1231
BssAI	RCCGGY	1 cut(s)	995
BssECI	CCNNGG	4 cut(s)	51, 75, 197, 386
BssMI	GATC	5 cut(s)	496, 615, 712, 1273, 1394
BssT1I	CCWWGG	2 cut(s)	75, 197
Bst2UI	CCWGG	2 cut(s)	388, 1242
Bst4CI	ACNGT	7 cut(s)	55, 673, 1046, 1061, 1097, 1250, 1307
Bst6I	CTCTTC	3 cut(s)	864, 1161, 1164
BstAFI	CTTAAG	1 cut(s)	1112
BstAUI	TGTACA	1 cut(s)	179
BstC8I	GCNNGC	2 cut(s)	393, 1407
BstDEI	CTNAG	4 cut(s)	408, 886, 1024, 1391
BstDSI	CCRYGG	2 cut(s)	51, 197
BstF5I	GGATG	2 cut(s)	71, 831
BstKTI	GATC	5 cut(s)	499, 618, 715, 1276, 1397
BstMAI	GTCTC	3 cut(s)	889, 1156, 1351
BstMBI	GATC	5 cut(s)	496, 615, 712, 1273, 1394
BstMWI	GCNNNNNNNGC	2 cut(s)	144, 791
BstNI	CCWGG	2 cut(s)	388, 1242
BstNSI	RCATGY	1 cut(s)	1409
BstSCI	CCNGG	3 cut(s)	123, 386, 1240
BstSFI	CTRYAG	2 cut(s)	873, 1290
BstSLI	GKGCMC	1 cut(s)	995
BstV1I	GCAGC	3 cut(s)	233, 1186, 1282
BstV2I	GAAGAC	1 cut(s)	96
BstX2I	RGATCY	2 cut(s)	496, 615
BstXI	CCANNNNNNTGG	2 cut(s)	760, 1363
BstYI	RGATCY	2 cut(s)	496, 615
BsuRI	GGCC	2 cut(s)	317, 391
BtgI	CCRYGG	2 cut(s)	51, 197
BtsCI	GGATG	2 cut(s)	71, 831
BtsI	GCAGTG	1 cut(s)	938
BtsIMutI	CAGTG	4 cut(s)	938, 995, 1042, 1137
BveI	ACCTGC	1 cut(s)	1489
Cac8I	GCNNGC	2 cut(s)	393, 1407
Cfr10I	RCCGGY	1 cut(s)	995
Cfr13I	GGNCC	2 cut(s)	746, 917
Csp6I	GTAC	7 cut(s)	80, 180, 304, 383, 431, 973, 1353
CspAI	ACCGGT	1 cut(s)	995
CspCI	CAANNNNNGTGG	2 cut(s)	307, 342
CviAII	CATG	9 cut(s)	177, 186, 198, 368, 570, 701, 836, 1357, 1406
CviQI	GTAC	7 cut(s)	80, 180, 304, 383, 431, 973, 1353
DdeI	CTNAG	4 cut(s)	408, 886, 1024, 1391
DpnI	GATC	5 cut(s)	498, 617, 714, 1275, 1396
DpnII	GATC	5 cut(s)	496, 615, 712, 1273, 1394
DraIII	CACNNNGTG	1 cut(s)	1048
DrdI	GACNNNNNNGTC	1 cut(s)	1148
DseDI	GACNNNNNNGTC	1 cut(s)	1148
EaeI	YGGCCR	1 cut(s)	389
Eam1104I	CTCTTC	3 cut(s)	864, 1161, 1164
EarI	CTCTTC	3 cut(s)	864, 1161, 1164
Ecl136II	GAGCTC	2 cut(s)	1083, 1174
Eco130I	CCWWGG	2 cut(s)	75, 197
Eco24I	GRGCYC	2 cut(s)	1085, 1176
Eco47I	GGWCC	2 cut(s)	746, 917
Eco53kI	GAGCTC	2 cut(s)	1083, 1174
Eco57I	CTGAAG	3 cut(s)	281, 1145, 1188
Eco88I	CYCGRG	1 cut(s)	26
EcoICRI	GAGCTC	2 cut(s)	1083, 1174
EcoRI	GAATTC	1 cut(s)	1324
EcoRII	CCWGG	2 cut(s)	386, 1240
EcoT14I	CCWWGG	2 cut(s)	75, 197
EcoT22I	ATGCAT	3 cut(s)	796, 1039, 1411
EcoT38I	GRGCYC	2 cut(s)	1085, 1176
ErhI	CCWWGG	2 cut(s)	75, 197
Esp3I	CGTCTC	1 cut(s)	1156
FaeI	CATG	9 cut(s)	180, 189, 201, 371, 573, 704, 839, 1360, 1409
FalI	AAGNNNNNCTT	4 cut(s)	1095, 1127, 1428, 1460
FaqI	GGGAC	2 cut(s)	158, 882
FatI	CATG	9 cut(s)	176, 185, 197, 367, 569, 700, 835, 1356, 1405
FblI	GTMKAC	1 cut(s)	823
Fnu4HI	GCNGC	3 cut(s)	247, 1200, 1296
FokI	GGATG	2 cut(s)	58, 818
FriOI	GRGCYC	2 cut(s)	1085, 1176
Fsp4HI	GCNGC	3 cut(s)	247, 1200, 1296
FspBI	CTAG	4 cut(s)	434, 707, 1277, 1350
GluI	GCNGC	3 cut(s)	247, 1200, 1296
HaeIII	GGCC	2 cut(s)	317, 391
HapII	CCGG	3 cut(s)	124, 527, 996
Hin1II	CATG	9 cut(s)	180, 189, 201, 371, 573, 704, 839, 1360, 1409
HincII	GTYRAC	2 cut(s)	439, 824
HindII	GTYRAC	2 cut(s)	439, 824
HindIII	AAGCTT	1 cut(s)	802
HinfI	GANTC	4 cut(s)	332, 530, 1280, 1334
HpaII	CCGG	3 cut(s)	124, 527, 996
HphI	GGTGA	1 cut(s)	670
Hpy166II	GTNNAC	7 cut(s)	58, 383, 439, 661, 824, 920, 993
Hpy188III	TCNNGA	5 cut(s)	527, 798, 962, 1271, 1277
Hpy8I	GTNNAC	7 cut(s)	58, 383, 439, 661, 824, 920, 993
HpyAV	CCTTC	3 cut(s)	305, 414, 734
HpyCH4III	ACNGT	7 cut(s)	55, 673, 1046, 1061, 1097, 1250, 1307
HpyF10VI	GCNNNNNNNGC	2 cut(s)	144, 791
HpyF3I	CTNAG	4 cut(s)	408, 886, 1024, 1391
Hsp92II	CATG	9 cut(s)	180, 189, 201, 371, 573, 704, 839, 1360, 1409
Kpn2I	TCCGGA	1 cut(s)	526
Kzo9I	GATC	5 cut(s)	496, 615, 712, 1273, 1394
LguI	GCTCTTC	1 cut(s)	1164
LmnI	GCTCC	2 cut(s)	212, 1489
Lsp1109I	GCAGC	3 cut(s)	233, 1186, 1282
LweI	GCATC	4 cut(s)	80, 589, 803, 1155
MaeI	CTAG	4 cut(s)	434, 707, 1277, 1350
MaeIII	GTNAC	1 cut(s)	16
MalI	GATC	5 cut(s)	498, 617, 714, 1275, 1396
MboI	GATC	5 cut(s)	496, 615, 712, 1273, 1394
MflI	RGATCY	2 cut(s)	496, 615
MhlI	GDGCHC	4 cut(s)	995, 1085, 1176, 1494
MlsI	TGGCCA	1 cut(s)	391
MluCI	AATT	8 cut(s)	5, 324, 489, 536, 542, 651, 1324, 1422
MluNI	TGGCCA	1 cut(s)	391
MlyI	GAGTC	1 cut(s)	1328
MmeI	TCCRAC	2 cut(s)	773, 1447
Mox20I	TGGCCA	1 cut(s)	391
Mph1103I	ATGCAT	3 cut(s)	796, 1039, 1411
MroI	TCCGGA	1 cut(s)	526
MscI	TGGCCA	1 cut(s)	391
MseI	TTAA	8 cut(s)	113, 323, 477, 954, 1092, 1113, 1235, 1373
MslI	CAYNNNNRTG	3 cut(s)	366, 588, 982
Msp20I	TGGCCA	1 cut(s)	391
MspCI	CTTAAG	1 cut(s)	1112
MspI	CCGG	3 cut(s)	124, 527, 996
MspR9I	CCNGG	3 cut(s)	125, 388, 1242
Mva1269I	GAATGC	1 cut(s)	270
MvaI	CCWGG	2 cut(s)	388, 1242
MwoI	GCNNNNNNNGC	2 cut(s)	144, 791
NciI	CCSGG	1 cut(s)	125
NcoI	CCATGG	1 cut(s)	197
NdeII	GATC	5 cut(s)	496, 615, 712, 1273, 1394
NlaIII	CATG	9 cut(s)	180, 189, 201, 371, 573, 704, 839, 1360, 1409
NlaIV	GGNNCC	1 cut(s)	463
NsiI	ATGCAT	3 cut(s)	796, 1039, 1411
NspI	RCATGY	1 cut(s)	1409
PaeI	GCATGC	1 cut(s)	1409
PciSI	GCTCTTC	1 cut(s)	1164
PctI	GAATGC	1 cut(s)	270
PfeI	GAWTC	3 cut(s)	332, 530, 1280
PflMI	CCANNNNNTGG	1 cut(s)	926
PinAI	ACCGGT	1 cut(s)	995
PkrI	GCNGC	3 cut(s)	248, 1201, 1297
PleI	GAGTC	1 cut(s)	1328
PpsI	GAGTC	1 cut(s)	1328
PshBI	ATTAAT	1 cut(s)	477
Psp124BI	GAGCTC	2 cut(s)	1085, 1176
Psp6I	CCWGG	2 cut(s)	386, 1240
PspGI	CCWGG	2 cut(s)	386, 1240
PspN4I	GGNNCC	1 cut(s)	463
PspPI	GGNCC	2 cut(s)	746, 917
PsrI	GAACNNNNNNTAC	2 cut(s)	172, 204
PsuI	RGATCY	2 cut(s)	496, 615
RsaI	GTAC	7 cut(s)	81, 181, 305, 384, 432, 974, 1354
RsaNI	GTAC	7 cut(s)	80, 180, 304, 383, 431, 973, 1353
RseI	CAYNNNNRTG	3 cut(s)	366, 588, 982
SacI	GAGCTC	2 cut(s)	1085, 1176
SalI	GTCGAC	1 cut(s)	822
SapI	GCTCTTC	1 cut(s)	1164
SaqAI	TTAA	8 cut(s)	113, 323, 477, 954, 1092, 1113, 1235, 1373
SatI	GCNGC	3 cut(s)	247, 1200, 1296
Sau3AI	GATC	5 cut(s)	496, 615, 712, 1273, 1394
Sau96I	GGNCC	2 cut(s)	746, 917
ScaI	AGTACT	2 cut(s)	432, 974
SchI	GAGTC	1 cut(s)	1328
ScrFI	CCNGG	3 cut(s)	125, 388, 1242
SduI	GDGCHC	4 cut(s)	995, 1085, 1176, 1494
SfaNI	GCATC	4 cut(s)	80, 589, 803, 1155
SfcI	CTRYAG	2 cut(s)	873, 1290
SinI	GGWCC	2 cut(s)	746, 917
SmiMI	CAYNNNNRTG	3 cut(s)	366, 588, 982
SmlI	CTYRAG	3 cut(s)	66, 902, 1112
SmoI	CTYRAG	3 cut(s)	66, 902, 1112
SpeI	ACTAGT	1 cut(s)	433
SphI	GCATGC	1 cut(s)	1409
Sse9I	AATT	8 cut(s)	5, 324, 489, 536, 542, 651, 1324, 1422
SspI	AATATT	2 cut(s)	111, 1180
SspMI	CTAG	4 cut(s)	434, 707, 1277, 1350
SstI	GAGCTC	2 cut(s)	1085, 1176
StyD4I	CCNGG	3 cut(s)	123, 386, 1240
StyI	CCWWGG	2 cut(s)	75, 197
TaaI	ACNGT	7 cut(s)	55, 673, 1046, 1061, 1097, 1250, 1307
TaqI	TCGA	4 cut(s)	427, 533, 823, 982
TasI	AATT	8 cut(s)	5, 324, 489, 536, 542, 651, 1324, 1422
TatI	WGTACW	4 cut(s)	179, 303, 430, 972
TfiI	GAWTC	3 cut(s)	332, 530, 1280
Tru1I	TTAA	8 cut(s)	113, 323, 477, 954, 1092, 1113, 1235, 1373
Tru9I	TTAA	8 cut(s)	113, 323, 477, 954, 1092, 1113, 1235, 1373
TscAI	CASTG	4 cut(s)	938, 995, 1049, 1144
TseI	GCWGC	3 cut(s)	246, 1199, 1295
TspDTI	ATGAA	8 cut(s)	17, 168, 263, 698, 717, 851, 1025, 1221
TspRI	CASTG	4 cut(s)	938, 995, 1049, 1144
Van91I	CCANNNNNTGG	1 cut(s)	926
Vha464I	CTTAAG	1 cut(s)	1112
VneI	GTGCAC	1 cut(s)	991
VpaK11BI	GGWCC	2 cut(s)	746, 917
VspI	ATTAAT	1 cut(s)	477
XapI	RAATTY	2 cut(s)	489, 1324
XbaI	TCTAGA	1 cut(s)	1276
XceI	RCATGY	1 cut(s)	1409
XcmI	CCANNNNNNNNNTGG	1 cut(s)	1238
XmiI	GTMKAC	1 cut(s)	823
XspI	CTAG	4 cut(s)	434, 707, 1277, 1350
ZrmI	AGTACT	2 cut(s)	432, 974
Zsp2I	ATGCAT	3 cut(s)	796, 1039, 1411

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.