Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0026514.1

Orthogroup ID

OG0018021

Physical Location & Seq

Genomic Coordinates Forward (+)

66 .. 575

Gene Structure 510 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0026514.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 414 bp

atgtcgggtttcactgagagtgccgaaactgctgtcgtcacagaggataaagcagctctttggacagatggtcgctattatcttcaggccggttctgaagcggacgtctgcactttgctaaagtgcggacggcgacgcagcaacggcgttccaggcggcgacggcggctcggggcttggcgaacggaggcaggaggcttggcggactggtctgggcagcgttcgaggtcggaggaggtccgagttgcaggttctgggcagcaacccgacctgcaactgcaggttttctgggcagcgctgcaacgacgtcgccgcgactgcagccctctccgcccgacccctggcgtccttcaggcaacctccgccgctccgttgcacctcgagccgagctgcagcagcgccgtccgcactttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009532 GO:0009536 GO:0009570 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044446 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Creatinase_N Creatinase_N_2 Peptidase_M24 Peptidase_M24_C

Protein Analysis

137

Amino Acids

14.45

Weight (kDa)

9.6

Isoelectric Point (pI)

73.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018021)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g05630 FvH4_4g17470
rosa_chinensis	RchiOBHm_Chr1g0378451
rosa_laevigata	RLG00000028423
rosa_multiflora	Rmu_sc0026514.1_g000001
rosa_roxburghii	Rroxscaffold_1G00071590 Rroxscaffold_1G00071830 Rroxscaffold_2G00138070
rosa_rugosa	Rorug02G0090500 Rorug04G0294700
rosa_samantha	Rh2AG139300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	2 cut(s)	108, 309
Acc36I	ACCTGC	3 cut(s)	238, 270, 278
AccBSI	CCGCTC	1 cut(s)	367
AccII	CGCG	1 cut(s)	314
AcuI	CTGAAG	3 cut(s)	68, 117, 334
AcyI	GRCGYC	3 cut(s)	105, 306, 344
AfeI	AGCGCT	1 cut(s)	296
AfiI	CCNNNNNNNGG	1 cut(s)	340
AhdI	GACNNNNNGTC	1 cut(s)	69
AjnI	CCWGG	2 cut(s)	151, 339
AluBI	AGCT	2 cut(s)	56, 389
AluI	AGCT	2 cut(s)	56, 389
AlwNI	CAGNNNCTG	1 cut(s)	253
Ama87I	CYCGRG	2 cut(s)	169, 379
Aor51HI	AGCGCT	1 cut(s)	296
AoxI	GGCC	1 cut(s)	87
ArsI	GACNNNNNNTTYG	2 cut(s)	18, 50
AspLEI	GCGC	2 cut(s)	297, 400
AspS9I	GGNCC	1 cut(s)	237
AvaI	CYCGRG	2 cut(s)	169, 379
AvaII	GGWCC	1 cut(s)	237
BccI	CCATC	1 cut(s)	62
BceAI	ACGGC	4 cut(s)	146, 160, 178, 385
BcgI	CGANNNNNNTGC	2 cut(s)	289, 323
BciT130I	CCWGG	2 cut(s)	153, 341
BfmI	CTRYAG	3 cut(s)	277, 318, 390
BfoI	RGCGCY	2 cut(s)	298, 401
BfuAI	ACCTGC	3 cut(s)	238, 270, 278
Bme1390I	CCNGG	2 cut(s)	153, 341
Bme18I	GGWCC	1 cut(s)	237
BmeRI	GACNNNNNGTC	1 cut(s)	69
BmeT110I	CYCGRG	2 cut(s)	169, 379
BmgT120I	GGNCC	1 cut(s)	237
BmrFI	CCNGG	2 cut(s)	153, 341
BsaHI	GRCGYC	3 cut(s)	105, 306, 344
BsaJI	CCNNGG	1 cut(s)	339
Bsc4I	CCNNNNNNNGG	1 cut(s)	340
Bse118I	RCCGGY	1 cut(s)	89
Bse1I	ACTGG	1 cut(s)	211
BseBI	CCWGG	2 cut(s)	153, 341
BseDI	CCNNGG	1 cut(s)	339
BseLI	CCNNNNNNNGG	1 cut(s)	340
BseMII	CTCAG	1 cut(s)	6
BseNI	ACTGG	1 cut(s)	211
BseRI	GAGGAG	1 cut(s)	247
BsgI	GTGCAG	1 cut(s)	94
Bsh1236I	CGCG	1 cut(s)	314
BshFI	GGCC	1 cut(s)	89
BsiHKCI	CYCGRG	2 cut(s)	169, 379
BsiSI	CCGG	1 cut(s)	90
BslI	CCNNNNNNNGG	1 cut(s)	340
BsnI	GGCC	1 cut(s)	89
BsoBI	CYCGRG	2 cut(s)	169, 379
BspANI	GGCC	1 cut(s)	89
BspCNI	CTCAG	1 cut(s)	7
BspFNI	CGCG	1 cut(s)	314
BspMAI	CTGCAG	3 cut(s)	281, 322, 394
BspMI	ACCTGC	3 cut(s)	238, 270, 278
BsrBI	CCGCTC	1 cut(s)	367
BsrFI	RCCGGY	1 cut(s)	89
BsrI	ACTGG	1 cut(s)	211
BssAI	RCCGGY	1 cut(s)	89
BssECI	CCNNGG	1 cut(s)	339
BssNI	GRCGYC	3 cut(s)	105, 306, 344
Bst2UI	CCWGG	2 cut(s)	153, 341
BstACI	GRCGYC	3 cut(s)	105, 306, 344
BstDEI	CTNAG	1 cut(s)	15
BstFNI	CGCG	1 cut(s)	314
BstH2I	RGCGCY	2 cut(s)	298, 401
BstHHI	GCGC	2 cut(s)	297, 400
BstNI	CCWGG	2 cut(s)	153, 341
BstSCI	CCNGG	2 cut(s)	151, 339
BstSFI	CTRYAG	3 cut(s)	277, 318, 390
BstUI	CGCG	1 cut(s)	314
BsuRI	GGCC	1 cut(s)	89
BtsIMutI	CAGTG	1 cut(s)	12
BveI	ACCTGC	3 cut(s)	238, 270, 278
CaiI	CAGNNNCTG	1 cut(s)	253
CfoI	GCGC	2 cut(s)	297, 400
Cfr10I	RCCGGY	1 cut(s)	89
Cfr13I	GGNCC	1 cut(s)	237
CseI	GACGC	2 cut(s)	144, 333
CviJI	RGCY	8 cut(s)	56, 89, 168, 175, 197, 323, 384, 389
CviKI_1	RGCY	8 cut(s)	56, 89, 168, 175, 197, 323, 384, 389
DdeI	CTNAG	1 cut(s)	15
DriI	GACNNNNNGTC	1 cut(s)	69
Eam1105I	GACNNNNNGTC	1 cut(s)	69
EciI	GGCGGA	3 cut(s)	217, 319, 351
Eco47I	GGWCC	1 cut(s)	237
Eco47III	AGCGCT	1 cut(s)	296
Eco57I	CTGAAG	3 cut(s)	68, 117, 334
Eco88I	CYCGRG	2 cut(s)	169, 379
EcoRII	CCWGG	2 cut(s)	151, 339
FalI	AAGNNNNNCTT	2 cut(s)	42, 74
GlaI	GCGC	2 cut(s)	296, 399
HaeII	RGCGCY	2 cut(s)	298, 401
HaeIII	GGCC	1 cut(s)	89
HapII	CCGG	1 cut(s)	90
HgaI	GACGC	2 cut(s)	144, 333
HhaI	GCGC	2 cut(s)	297, 400
Hin1I	GRCGYC	3 cut(s)	105, 306, 344
Hin6I	GCGC	2 cut(s)	295, 398
HinP1I	GCGC	2 cut(s)	295, 398
HpaII	CCGG	1 cut(s)	90
Hpy188I	TCNGA	3 cut(s)	97, 231, 241
Hpy99I	CGWCG	4 cut(s)	138, 164, 308, 311
HpyAV	CCTTC	1 cut(s)	358
HpyCH4IV	ACGT	2 cut(s)	105, 306
HpyCH4V	TGCA	8 cut(s)	111, 247, 273, 279, 300, 320, 375, 392
HpyF3I	CTNAG	1 cut(s)	15
HpySE526I	ACGT	2 cut(s)	105, 306
Hsp92I	GRCGYC	3 cut(s)	105, 306, 344
HspAI	GCGC	2 cut(s)	295, 398
LmnI	GCTCC	1 cut(s)	372
MaeII	ACGT	2 cut(s)	105, 306
MaeIII	GTNAC	1 cut(s)	37
MbiI	CCGCTC	1 cut(s)	367
MboII	GAAGA	1 cut(s)	74
MmeI	TCCRAC	1 cut(s)	209
MnlI	CCTC	9 cut(s)	37, 180, 187, 218, 225, 228, 335, 369, 388
MseI	TTAA	1 cut(s)	412
MspI	CCGG	1 cut(s)	90
MspR9I	CCNGG	2 cut(s)	153, 341
MvaI	CCWGG	2 cut(s)	153, 341
MvnI	CGCG	1 cut(s)	314
NmeAIII	GCCGAG	1 cut(s)	410
NmuCI	GTSAC	1 cut(s)	37
PaeR7I	CTCGAG	1 cut(s)	379
Psp6I	CCWGG	2 cut(s)	151, 339
PspGI	CCWGG	2 cut(s)	151, 339
PspPI	GGNCC	1 cut(s)	237
PspXI	VCTCGAGB	1 cut(s)	379
PstI	CTGCAG	3 cut(s)	281, 322, 394
PstNI	CAGNNNCTG	1 cut(s)	253
SaqAI	TTAA	1 cut(s)	412
Sau96I	GGNCC	1 cut(s)	237
ScrFI	CCNGG	2 cut(s)	153, 341
SfcI	CTRYAG	3 cut(s)	277, 318, 390
Sfr274I	CTCGAG	1 cut(s)	379
SinI	GGWCC	1 cut(s)	237
SlaI	CTCGAG	1 cut(s)	379
SmlI	CTYRAG	1 cut(s)	379
SmoI	CTYRAG	1 cut(s)	379
StyD4I	CCNGG	2 cut(s)	151, 339
TaiI	ACGT	2 cut(s)	108, 309
TaqI	TCGA	2 cut(s)	223, 380
TauI	GCSGC	4 cut(s)	159, 168, 314, 367
Tru1I	TTAA	1 cut(s)	412
Tru9I	TTAA	1 cut(s)	412
TscAI	CASTG	1 cut(s)	19
TseFI	GTSAC	1 cut(s)	37
Tsp45I	GTSAC	1 cut(s)	37
TspGWI	ACGGA	2 cut(s)	199, 359
TspRI	CASTG	1 cut(s)	19
VpaK11BI	GGWCC	1 cut(s)	237
XhoI	CTCGAG	1 cut(s)	379
ZraI	GACGTC	2 cut(s)	106, 307

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.