Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0031135.1

Orthogroup ID

OG0004805

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 3401

Gene Structure 3401 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0031135.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 960 bp

gcaattcgacatgaagctttcacacatatggagggccagaaagagtttgtgcaaattgaccagaacgaattatatccctatcttcttgttaatattgggtccggtgttagtatgattaaggttgatggagaaggaaaatttcagcgagtaagtggaacaaatgtaggtggtggtacctattggggcttaggaaggctgttaacaaaatgcaaaagttttgacgagttgttagagcttagtcaaaggggagataataggactatagacatgcttgtaggggacatttatggcggtatggattactcaaagattggtctttcagcttcaaccattgcttctagttttgggaagactatttcagaaaacaaggagcttgaggactacagacctgaagatatatccctttctctcttacgaatgatttcttacaatattggtcagatatcttatttaaatgcactacgattcggtctcaaacggatattttttggagggttttttattagaggccatgcttataccatggacaccatctcctttgcagttcagttctggtcgaaaggagaggcacaggcaatgtttttgagacatgaagggtttctgggagcgttaggtgcatttatgagctatgaaaaacatggccttgatgacttgatggtccatcacttagttgaaaggtttcccatgggcgcaccatatacaggaggaaagattcatggtccaccactaggggatttgaatgagaagatttcatggatggagaagtttgttcggaaggggactgagatcaccgctccagtgccaatggatccacctggaactactggacttggaggctttgaagttccatcatccaaaggaggtaccctgcgctctgatgcaagtgctttaaacattggggttctccatctggtacccactttggaagtatttccattattggtggatcccaaatcgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004594 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0006793 GO:0006796 GO:0008150 GO:0008152 GO:0009987 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0044237 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00770 ko01100 map00770 map01100

Pfam Domains

Protein Families

DUF89 Fumble

Protein Analysis

319

Amino Acids

35.13

Weight (kDa)

6.01

Isoelectric Point (pI)

26.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004805)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G32180 AT4G32180 AT4G32180
fragaria_vesca	FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350 FvH4_5g05350
malus_domestica	MD06G1173300.v1.1 MD14G1179800.v1.1
prunus_persica	Prupe.5G172800_v2.0.a1 Prupe.5G172800_v2.0.a1
pyrus_communis	pycom06g15440 pycom14g14960
rosa_chinensis	RchiOBHm_Chr7g0193481
rosa_laevigata	RLG00000004267
rosa_multiflora	Rmu_sc0006629.1_g000003 Rmu_sc0012783.1_g000004 Rmu_sc0031135.1_g000001
rosa_roxburghii	Rroxscaffold_3G00262060
rosa_rugosa	Rorug07G0009700 Rorug07G0009700
rosa_samantha	Rh7AG136400 Rh7BG136800 Rh7CG140200 Rh7DG138000
rosa_wichuraiana	Rw7G011630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	656
Acc65I	GGTACC	3 cut(s)	173, 863, 913
AccB1I	GGYRCC	3 cut(s)	173, 863, 913
AccBSI	CCGCTC	1 cut(s)	794
AciI	CCGC	2 cut(s)	291, 792
AclWI	GGATC	4 cut(s)	803, 816, 941, 954
AcsI	RAATTY	1 cut(s)	137
AcuI	CTGAAG	1 cut(s)	411
AfaI	GTAC	3 cut(s)	175, 865, 915
AfiI	CCNNNNNNNGG	2 cut(s)	701, 728
AgsI	TTSAA	4 cut(s)	327, 674, 739, 842
AjnI	CCWGG	1 cut(s)	814
AluBI	AGCT	5 cut(s)	17, 235, 323, 373, 627
AluI	AGCT	5 cut(s)	17, 235, 323, 373, 627
Alw26I	GTCTC	2 cut(s)	476, 580
AlwI	GGATC	4 cut(s)	803, 816, 941, 954
AoxI	GGCC	3 cut(s)	34, 508, 640
ApoI	RAATTY	1 cut(s)	137
Asp700I	GAANNNNTTC	4 cut(s)	421, 597, 678, 930
Asp718I	GGTACC	3 cut(s)	173, 863, 913
AspLEI	GCGC	2 cut(s)	692, 873
AspS9I	GGNCC	4 cut(s)	34, 99, 658, 719
AsuHPI	GGTGA	1 cut(s)	781
AvaII	GGWCC	3 cut(s)	99, 658, 719
BamHI	GGATCC	2 cut(s)	808, 946
BanI	GGYRCC	3 cut(s)	173, 863, 913
BbsI	GAAGAC	1 cut(s)	356
BccI	CCATC	7 cut(s)	119, 539, 649, 669, 751, 856, 915
BciT130I	CCWGG	1 cut(s)	816
BcoDI	GTCTC	2 cut(s)	476, 580
BfaI	CTAG	2 cut(s)	339, 728
BfmI	CTRYAG	2 cut(s)	261, 382
Bme1390I	CCNGG	1 cut(s)	816
Bme18I	GGWCC	3 cut(s)	99, 658, 719
BmgT120I	GGNCC	4 cut(s)	34, 99, 658, 719
BmiI	GGNNCC	6 cut(s)	100, 175, 810, 865, 915, 948
BmrFI	CCNGG	1 cut(s)	816
BmsI	GCATC	1 cut(s)	868
BpiI	GAAGAC	1 cut(s)	356
BpmI	CTGGAG	1 cut(s)	780
Bpu10I	CCTNAGC	1 cut(s)	187
BpuEI	CTTGAG	1 cut(s)	395
BsaI	GGTCTC	1 cut(s)	476
BsaJI	CCNNGG	2 cut(s)	522, 684
BsaWI	WCCGGW	1 cut(s)	101
BsaXI	ACNNNNNCTCC	2 cut(s)	518, 548
Bsc4I	CCNNNNNNNGG	2 cut(s)	701, 728
Bse1I	ACTGG	2 cut(s)	797, 829
Bse3DI	GCAATG	2 cut(s)	330, 582
BseBI	CCWGG	1 cut(s)	816
BseDI	CCNNGG	2 cut(s)	522, 684
BseGI	GGATG	2 cut(s)	762, 851
BseLI	CCNNNNNNNGG	2 cut(s)	701, 728
BseMI	GCAATG	2 cut(s)	330, 582
BseMII	CTCAG	1 cut(s)	774
BseNI	ACTGG	2 cut(s)	797, 829
BshFI	GGCC	3 cut(s)	36, 510, 642
BshNI	GGYRCC	3 cut(s)	173, 863, 913
BsiSI	CCGG	1 cut(s)	102
BslFI	GGGAC	2 cut(s)	293, 793
BslI	CCNNNNNNNGG	2 cut(s)	701, 728
BsmAI	GTCTC	2 cut(s)	476, 580
BsmFI	GGGAC	2 cut(s)	293, 793
BsnI	GGCC	3 cut(s)	36, 510, 642
Bso31I	GGTCTC	1 cut(s)	476
Bsp143I	GATC	3 cut(s)	786, 808, 946
Bsp19I	CCATGG	2 cut(s)	522, 684
BspACI	CCGC	2 cut(s)	291, 792
BspANI	GGCC	3 cut(s)	36, 510, 642
BspCNI	CTCAG	1 cut(s)	775
BspLI	GGNNCC	6 cut(s)	100, 175, 810, 865, 915, 948
BspPI	GGATC	4 cut(s)	803, 816, 941, 954
BspT107I	GGYRCC	3 cut(s)	173, 863, 913
BspTNI	GGTCTC	1 cut(s)	476
BsrBI	CCGCTC	1 cut(s)	794
BsrDI	GCAATG	2 cut(s)	330, 582
BsrI	ACTGG	2 cut(s)	797, 829
BssECI	CCNNGG	2 cut(s)	522, 684
BssMI	GATC	3 cut(s)	786, 808, 946
BssT1I	CCWWGG	2 cut(s)	522, 684
Bst2UI	CCWGG	1 cut(s)	816
BstDEI	CTNAG	4 cut(s)	187, 236, 667, 783
BstDSI	CCRYGG	2 cut(s)	522, 684
BstF5I	GGATG	2 cut(s)	762, 851
BstHHI	GCGC	2 cut(s)	692, 873
BstKTI	GATC	3 cut(s)	789, 811, 949
BstMAI	GTCTC	2 cut(s)	476, 580
BstMBI	GATC	3 cut(s)	786, 808, 946
BstMWI	GCNNNNNNNGC	1 cut(s)	614
BstNI	CCWGG	1 cut(s)	816
BstNSI	RCATGY	1 cut(s)	271
BstSCI	CCNGG	1 cut(s)	814
BstSFI	CTRYAG	2 cut(s)	261, 382
BstV2I	GAAGAC	1 cut(s)	356
BstX2I	RGATCY	2 cut(s)	808, 946
BstYI	RGATCY	2 cut(s)	808, 946
BsuRI	GGCC	3 cut(s)	36, 510, 642
BtgI	CCRYGG	2 cut(s)	522, 684
BtsCI	GGATG	2 cut(s)	762, 851
BtsIMutI	CAGTG	1 cut(s)	804
CfoI	GCGC	2 cut(s)	692, 873
Cfr13I	GGNCC	4 cut(s)	34, 99, 658, 719
Csp6I	GTAC	3 cut(s)	174, 864, 914
CviAII	CATG	9 cut(s)	11, 268, 512, 523, 590, 638, 685, 716, 753
CviQI	GTAC	3 cut(s)	174, 864, 914
DdeI	CTNAG	4 cut(s)	187, 236, 667, 783
DpnI	GATC	3 cut(s)	788, 810, 948
DpnII	GATC	3 cut(s)	786, 808, 946
DraI	TTTAAA	2 cut(s)	453, 891
DrdI	GACNNNNNNGTC	1 cut(s)	656
DseDI	GACNNNNNNGTC	1 cut(s)	656
Eco130I	CCWWGG	2 cut(s)	522, 684
Eco31I	GGTCTC	1 cut(s)	476
Eco32I	GATATC	1 cut(s)	444
Eco47I	GGWCC	3 cut(s)	99, 658, 719
Eco57I	CTGAAG	1 cut(s)	411
EcoRII	CCWGG	1 cut(s)	814
EcoRV	GATATC	1 cut(s)	444
EcoT14I	CCWWGG	2 cut(s)	522, 684
ErhI	CCWWGG	2 cut(s)	522, 684
FaeI	CATG	9 cut(s)	14, 271, 515, 526, 593, 641, 688, 719, 756
FaqI	GGGAC	2 cut(s)	293, 793
FatI	CATG	9 cut(s)	10, 267, 511, 522, 589, 637, 684, 715, 752
FauNDI	CATATG	1 cut(s)	27
FokI	GGATG	2 cut(s)	769, 838
FspBI	CTAG	2 cut(s)	339, 728
GlaI	GCGC	2 cut(s)	691, 872
GsuI	CTGGAG	1 cut(s)	780
HaeIII	GGCC	3 cut(s)	36, 510, 642
HapII	CCGG	1 cut(s)	102
HhaI	GCGC	2 cut(s)	692, 873
Hin1II	CATG	9 cut(s)	14, 271, 515, 526, 593, 641, 688, 719, 756
Hin6I	GCGC	2 cut(s)	690, 871
HinP1I	GCGC	2 cut(s)	690, 871
HincII	GTYRAC	1 cut(s)	201
HindII	GTYRAC	1 cut(s)	201
HindIII	AAGCTT	1 cut(s)	15
HinfI	GANTC	2 cut(s)	465, 712
HpaI	GTTAAC	1 cut(s)	201
HpaII	CCGG	1 cut(s)	102
HphI	GGTGA	1 cut(s)	781
Hpy166II	GTNNAC	2 cut(s)	201, 722
Hpy188I	TCNGA	4 cut(s)	361, 441, 774, 877
Hpy8I	GTNNAC	2 cut(s)	201, 722
HpyAV	CCTTC	4 cut(s)	125, 186, 587, 769
HpyCH4V	TGCA	6 cut(s)	52, 210, 458, 542, 617, 881
HpyF10VI	GCNNNNNNNGC	1 cut(s)	614
HpyF3I	CTNAG	4 cut(s)	187, 236, 667, 783
Hsp92II	CATG	9 cut(s)	14, 271, 515, 526, 593, 641, 688, 719, 756
HspAI	GCGC	2 cut(s)	690, 871
KpnI	GGTACC	3 cut(s)	177, 867, 917
KspAI	GTTAAC	1 cut(s)	201
Kzo9I	GATC	3 cut(s)	786, 808, 946
LmnI	GCTCC	3 cut(s)	370, 605, 799
LweI	GCATC	1 cut(s)	868
MaeI	CTAG	2 cut(s)	339, 728
MalI	GATC	3 cut(s)	788, 810, 948
MbiI	CCGCTC	1 cut(s)	794
MboI	GATC	3 cut(s)	786, 808, 946
MboII	GAAGA	4 cut(s)	74, 361, 404, 757
MflI	RGATCY	2 cut(s)	808, 946
MluCI	AATT	4 cut(s)	3, 54, 68, 137
MnlI	CCTC	8 cut(s)	25, 370, 485, 500, 559, 698, 827, 854
MroXI	GAANNNNTTC	4 cut(s)	421, 597, 678, 930
MseI	TTAA	5 cut(s)	90, 117, 200, 452, 890
MslI	CAYNNNNRTG	1 cut(s)	26
MspI	CCGG	1 cut(s)	102
MspR9I	CCNGG	1 cut(s)	816
MvaI	CCWGG	1 cut(s)	816
MwoI	GCNNNNNNNGC	1 cut(s)	614
NcoI	CCATGG	2 cut(s)	522, 684
NdeI	CATATG	1 cut(s)	27
NdeII	GATC	3 cut(s)	786, 808, 946
NlaIII	CATG	9 cut(s)	14, 271, 515, 526, 593, 641, 688, 719, 756
NlaIV	GGNNCC	6 cut(s)	100, 175, 810, 865, 915, 948
NspI	RCATGY	1 cut(s)	271
PdmI	GAANNNNTTC	4 cut(s)	421, 597, 678, 930
PfeI	GAWTC	2 cut(s)	465, 712
Psp6I	CCWGG	1 cut(s)	814
PspGI	CCWGG	1 cut(s)	814
PspN4I	GGNNCC	6 cut(s)	100, 175, 810, 865, 915, 948
PspPI	GGNCC	4 cut(s)	34, 99, 658, 719
PsuI	RGATCY	2 cut(s)	808, 946
RsaI	GTAC	3 cut(s)	175, 865, 915
RsaNI	GTAC	3 cut(s)	174, 864, 914
RseI	CAYNNNNRTG	1 cut(s)	26
SaqAI	TTAA	5 cut(s)	90, 117, 200, 452, 890
Sau3AI	GATC	3 cut(s)	786, 808, 946
Sau96I	GGNCC	4 cut(s)	34, 99, 658, 719
ScrFI	CCNGG	1 cut(s)	816
SfaNI	GCATC	1 cut(s)	868
SfcI	CTRYAG	2 cut(s)	261, 382
SinI	GGWCC	3 cut(s)	99, 658, 719
SmiI	ATTTAAAT	1 cut(s)	453
SmiMI	CAYNNNNRTG	1 cut(s)	26
SmlI	CTYRAG	1 cut(s)	374
SmoI	CTYRAG	1 cut(s)	374
Sse9I	AATT	4 cut(s)	3, 54, 68, 137
SsiI	CCGC	2 cut(s)	291, 792
SspI	AATATT	2 cut(s)	94, 433
SspMI	CTAG	2 cut(s)	339, 728
StyD4I	CCNGG	1 cut(s)	814
StyI	CCWWGG	2 cut(s)	522, 684
SwaI	ATTTAAAT	1 cut(s)	453
TaqI	TCGA	2 cut(s)	7, 557
TaqII	GACCGA	1 cut(s)	458
TasI	AATT	4 cut(s)	3, 54, 68, 137
TfiI	GAWTC	2 cut(s)	465, 712
Tru1I	TTAA	5 cut(s)	90, 117, 200, 452, 890
Tru9I	TTAA	5 cut(s)	90, 117, 200, 452, 890
TscAI	CASTG	1 cut(s)	804
TspDTI	ATGAA	5 cut(s)	27, 606, 645, 704, 741
TspGWI	ACGGA	1 cut(s)	493
TspRI	CASTG	1 cut(s)	804
VpaK11BI	GGWCC	3 cut(s)	99, 658, 719
XapI	RAATTY	1 cut(s)	137
XceI	RCATGY	1 cut(s)	271
XmnI	GAANNNNTTC	4 cut(s)	421, 597, 678, 930
XspI	CTAG	2 cut(s)	339, 728

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.