Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0037386.1

Orthogroup ID

OG0012610

Physical Location & Seq

Genomic Coordinates Reverse (-)

3457 .. 6740

Gene Structure 3284 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0037386.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

atggcagcaccgccttatgatcacttcaagaagctcctcgtcctcggcgatagtggcgttgggaagaccagtctacttcttcgattctcggatatacctatagggacagaccttagtgtgaagaccatcgagatggacaacgaatgggtcaaactgcaaatctgtgacacaaacagtcaggaacgattattcaaaaaaatcacaagagcttgctacgaggcagctgatggtattttgttggtgtatgatgttacgaatgagtcatcatttctgcacgttagagactggattcggaaaaacatacattcttcttctaacaatgtgaagaaggtactggtggggaacaaggcggacatggatgatgagagcaaaagggctgtatcaagagctagaggtcaaactcttgcggatgtgtgcgacatcatgttcttggaaaccagtgcaaagacgaacaagaatgttgaagacggcgctgtaaggctgagaagctgcacagctcgagctggaaatcacctcccttcaccggctgatatcttccgattccggccacctccagcaataaaccttagtccattggaagcgccttgggacgtagatgatgctccccgaagcttttgccgagatttgaagtgtggaggaagaatcgacggtttgaagttggaggttagtgcaattgccaaattttggtggccattggagttggtggcagtggcggcggtagcggcggctaggtctgaaatcgacgagtgggcagtgttggtgaagtttggttggatgtggaagaggattggagaagttgaggttatggcattgatcttccgcctttgtggcgaggtgatgggatcaccgaagcccatctgcgtttgtggcgctggttactgtctttgtgacagtaatgctgaagcccagtatcctaatcgctacacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04144 ko04152 ko04530 ko04972 map04144 map04152 map04530 map04972

Pfam Domains

Protein Families

Ras

Protein Analysis

309

Amino Acids

34.36

Weight (kDa)

6.89

Isoelectric Point (pI)

38.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012610)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_5g01280
rosa_chinensis	RchiOBHm_Chr7g0199661 RchiOBHm_Chr7g0201581
rosa_multiflora	Rmu_co8364891.1_g000001 Rmu_sc0009191.1_g000003 Rmu_sc0010180.1_g000001 Rmu_sc0037386.1_g000003 Rmu_sc0039265.1_g000003
rosa_roxburghii	Rroxscaffold_3G00255230 Rroxscaffold_3G00256510
rosa_rugosa	Rorug07G0064800
rosa_samantha	Rh7AG180800 Rh7AG191400 Rh7BG183700 Rh7BG193700 Rh7CG202600 Rh7DG183700 Rh7DG196600
rosa_wichuraiana	Rw7G016780

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	684
AccI	GTMKAC	1 cut(s)	73
AciI	CCGC	8 cut(s)	11, 350, 407, 713, 716, 722, 725, 820
AclWI	GGATC	1 cut(s)	850
AcoI	YGGCCR	2 cut(s)	545, 689
AcsI	RAATTY	1 cut(s)	680
AcuI	CTGAAG	1 cut(s)	921
AfaI	GTAC	1 cut(s)	333
AfiI	CCNNNNNNNGG	2 cut(s)	523, 684
AgsI	TTSAA	5 cut(s)	28, 193, 464, 628, 655
AluBI	AGCT	8 cut(s)	34, 209, 224, 389, 489, 497, 503, 612
AluI	AGCT	8 cut(s)	34, 209, 224, 389, 489, 497, 503, 612
Alw26I	GTCTC	1 cut(s)	276
AlwI	GGATC	1 cut(s)	850
Ama87I	CYCGRG	1 cut(s)	498
AoxI	GGCC	2 cut(s)	545, 689
ApeKI	GCWGC	3 cut(s)	5, 221, 489
ApoI	RAATTY	1 cut(s)	680
AspLEI	GCGC	3 cut(s)	473, 583, 872
AsuHPI	GGTGA	5 cut(s)	503, 513, 772, 837, 847
AvaI	CYCGRG	1 cut(s)	498
BalI	TGGCCA	1 cut(s)	691
BbsI	GAAGAC	3 cut(s)	71, 128, 471
BbvI	GCAGC	3 cut(s)	17, 233, 476
BccI	CCATC	5 cut(s)	127, 134, 221, 832, 863
BceAI	ACGGC	1 cut(s)	484
BcgI	CGANNNNNNTGC	2 cut(s)	597, 631
BciVI	GTATCC	1 cut(s)	921
BclI	TGATCA	1 cut(s)	19
BcoDI	GTCTC	1 cut(s)	276
BfaI	CTAG	2 cut(s)	390, 729
BfmI	CTRYAG	1 cut(s)	99
BfoI	RGCGCY	3 cut(s)	474, 584, 873
BfuI	GTATCC	1 cut(s)	921
BglI	GCCNNNNNGGC	1 cut(s)	828
BisI	GCNGC	6 cut(s)	6, 222, 490, 714, 723, 726
BlsI	GCNGC	6 cut(s)	7, 223, 491, 715, 724, 727
BmeT110I	CYCGRG	1 cut(s)	498
BmrI	ACTGGG	1 cut(s)	901
BmsI	GCATC	1 cut(s)	589
BmuI	ACTGGG	1 cut(s)	901
BpiI	GAAGAC	3 cut(s)	71, 128, 471
BpmI	CTGGAG	1 cut(s)	537
BsaJI	CCNNGG	2 cut(s)	43, 584
Bsc4I	CCNNNNNNNGG	2 cut(s)	523, 684
Bse118I	RCCGGY	1 cut(s)	523
Bse1I	ACTGG	5 cut(s)	69, 290, 339, 438, 907
BseDI	CCNNGG	2 cut(s)	43, 584
BseGI	GGATG	3 cut(s)	364, 415, 780
BseLI	CCNNNNNNNGG	2 cut(s)	523, 684
BseMII	CTCAG	1 cut(s)	473
BseNI	ACTGG	5 cut(s)	69, 290, 339, 438, 907
BseRI	GAGGAG	1 cut(s)	26
BseXI	GCAGC	3 cut(s)	17, 233, 476
BsgI	GTGCAG	2 cut(s)	257, 475
BshFI	GGCC	2 cut(s)	547, 691
BsiHKCI	CYCGRG	1 cut(s)	498
BsiSI	CCGG	2 cut(s)	524, 544
BslFI	GGGAC	2 cut(s)	118, 602
BslI	CCNNNNNNNGG	2 cut(s)	523, 684
BsmAI	GTCTC	1 cut(s)	276
BsmFI	GGGAC	2 cut(s)	118, 602
BsnI	GGCC	2 cut(s)	547, 691
BsoBI	CYCGRG	1 cut(s)	498
Bsp143I	GATC	3 cut(s)	19, 813, 842
BspACI	CCGC	8 cut(s)	11, 350, 407, 713, 716, 722, 725, 820
BspANI	GGCC	2 cut(s)	547, 691
BspCNI	CTCAG	1 cut(s)	474
BspPI	GGATC	1 cut(s)	850
BsrFI	RCCGGY	1 cut(s)	523
BsrI	ACTGG	5 cut(s)	69, 290, 339, 438, 907
BssAI	RCCGGY	1 cut(s)	523
BssECI	CCNNGG	2 cut(s)	43, 584
BssMI	GATC	3 cut(s)	19, 813, 842
BssT1I	CCWWGG	1 cut(s)	584
Bst4CI	ACNGT	4 cut(s)	176, 650, 881, 893
Bst6I	CTCTTC	1 cut(s)	776
BstC8I	GCNNGC	1 cut(s)	211
BstDEI	CTNAG	4 cut(s)	113, 482, 566, 927
BstF5I	GGATG	3 cut(s)	364, 415, 780
BstH2I	RGCGCY	3 cut(s)	474, 584, 873
BstHHI	GCGC	3 cut(s)	473, 583, 872
BstKTI	GATC	3 cut(s)	22, 816, 845
BstMAI	GTCTC	1 cut(s)	276
BstMBI	GATC	3 cut(s)	19, 813, 842
BstMWI	GCNNNNNNNGC	6 cut(s)	54, 713, 719, 722, 828, 867
BstSFI	CTRYAG	1 cut(s)	99
BstV1I	GCAGC	3 cut(s)	17, 233, 476
BstV2I	GAAGAC	3 cut(s)	71, 128, 471
BstXI	CCANNNNNNTGG	1 cut(s)	133
BsuI	GTATCC	1 cut(s)	921
BsuRI	GGCC	2 cut(s)	547, 691
BtsCI	GGATG	3 cut(s)	364, 415, 780
BtsI	GCAGTG	2 cut(s)	714, 759
BtsIMutI	CAGTG	3 cut(s)	445, 714, 759
Cac8I	GCNNGC	1 cut(s)	211
CfoI	GCGC	3 cut(s)	473, 583, 872
Cfr10I	RCCGGY	1 cut(s)	523
Csp6I	GTAC	1 cut(s)	332
CviAII	CATG	2 cut(s)	355, 424
CviQI	GTAC	1 cut(s)	332
DdeI	CTNAG	4 cut(s)	113, 482, 566, 927
DpnI	GATC	3 cut(s)	21, 815, 844
DpnII	GATC	3 cut(s)	19, 813, 842
EaeI	YGGCCR	2 cut(s)	545, 689
Eam1104I	CTCTTC	1 cut(s)	776
EarI	CTCTTC	1 cut(s)	776
EciI	GGCGGA	2 cut(s)	365, 809
Eco130I	CCWWGG	1 cut(s)	584
Eco32I	GATATC	1 cut(s)	532
Eco57I	CTGAAG	1 cut(s)	921
Eco88I	CYCGRG	1 cut(s)	498
EcoRV	GATATC	1 cut(s)	532
EcoT14I	CCWWGG	1 cut(s)	584
ErhI	CCWWGG	1 cut(s)	584
FaeI	CATG	2 cut(s)	358, 427
FaiI	YATR	8 cut(s)	18, 95, 101, 246, 302, 356, 425, 806
FaqI	GGGAC	2 cut(s)	118, 602
FatI	CATG	2 cut(s)	354, 423
FbaI	TGATCA	1 cut(s)	19
FblI	GTMKAC	1 cut(s)	73
Fnu4HI	GCNGC	6 cut(s)	6, 222, 490, 714, 723, 726
FokI	GGATG	3 cut(s)	371, 422, 787
Fsp4HI	GCNGC	6 cut(s)	6, 222, 490, 714, 723, 726
FspBI	CTAG	2 cut(s)	390, 729
GlaI	GCGC	3 cut(s)	472, 582, 871
GluI	GCNGC	6 cut(s)	6, 222, 490, 714, 723, 726
GsuI	CTGGAG	1 cut(s)	537
HaeII	RGCGCY	3 cut(s)	474, 584, 873
HaeIII	GGCC	2 cut(s)	547, 691
HapII	CCGG	2 cut(s)	524, 544
HhaI	GCGC	3 cut(s)	473, 583, 872
Hin1II	CATG	2 cut(s)	358, 427
Hin6I	GCGC	3 cut(s)	471, 581, 870
HinP1I	GCGC	3 cut(s)	471, 581, 870
HindIII	AAGCTT	1 cut(s)	610
HinfI	GANTC	5 cut(s)	84, 260, 289, 540, 642
HpaII	CCGG	2 cut(s)	524, 544
HphI	GGTGA	5 cut(s)	503, 513, 772, 837, 847
Hpy166II	GTNNAC	1 cut(s)	74
Hpy188I	TCNGA	4 cut(s)	91, 294, 539, 736
Hpy188III	TCNNGA	4 cut(s)	28, 130, 179, 384
Hpy8I	GTNNAC	1 cut(s)	74
Hpy99I	CGWCG	2 cut(s)	650, 746
HpyAV	CCTTC	2 cut(s)	322, 528
HpyCH4III	ACNGT	4 cut(s)	176, 650, 881, 893
HpyCH4IV	ACGT	2 cut(s)	276, 591
HpyCH4V	TGCA	5 cut(s)	157, 274, 443, 492, 671
HpyF10VI	GCNNNNNNNGC	6 cut(s)	54, 713, 719, 722, 828, 867
HpyF3I	CTNAG	4 cut(s)	113, 482, 566, 927
HpySE526I	ACGT	2 cut(s)	276, 591
Hsp92II	CATG	2 cut(s)	358, 427
HspAI	GCGC	3 cut(s)	471, 581, 870
Ksp22I	TGATCA	1 cut(s)	19
Kzo9I	GATC	3 cut(s)	19, 813, 842
LmnI	GCTCC	2 cut(s)	39, 607
Lsp1109I	GCAGC	3 cut(s)	17, 233, 476
LweI	GCATC	1 cut(s)	589
MaeI	CTAG	2 cut(s)	390, 729
MaeII	ACGT	2 cut(s)	276, 591
MaeIII	GTNAC	4 cut(s)	164, 250, 875, 887
MalI	GATC	3 cut(s)	21, 815, 844
MboI	GATC	3 cut(s)	19, 813, 842
MfeI	CAATTG	1 cut(s)	672
MlsI	TGGCCA	1 cut(s)	691
MluCI	AATT	2 cut(s)	672, 680
MluNI	TGGCCA	1 cut(s)	691
MlyI	GAGTC	1 cut(s)	269
MmeI	TCCRAC	2 cut(s)	639, 752
Mox20I	TGGCCA	1 cut(s)	691
MscI	TGGCCA	1 cut(s)	691
MslI	CAYNNNNRTG	1 cut(s)	131
Msp20I	TGGCCA	1 cut(s)	691
MspA1I	CMGCKG	1 cut(s)	224
MspI	CCGG	2 cut(s)	524, 544
MunI	CAATTG	1 cut(s)	672
MwoI	GCNNNNNNNGC	6 cut(s)	54, 713, 719, 722, 828, 867
NdeII	GATC	3 cut(s)	19, 813, 842
NlaIII	CATG	2 cut(s)	358, 427
NmeAIII	GCCGAG	2 cut(s)	24, 644
NmuCI	GTSAC	2 cut(s)	164, 887
PaeR7I	CTCGAG	1 cut(s)	498
PcsI	WCGNNNNNNNCGW	1 cut(s)	45
PfeI	GAWTC	4 cut(s)	84, 289, 540, 642
PflMI	CCANNNNNTGG	1 cut(s)	684
PkrI	GCNGC	6 cut(s)	7, 223, 491, 715, 724, 727
PleI	GAGTC	1 cut(s)	268
PpsI	GAGTC	1 cut(s)	268
PspXI	VCTCGAGB	1 cut(s)	498
PvuII	CAGCTG	1 cut(s)	224
RsaI	GTAC	1 cut(s)	333
RsaNI	GTAC	1 cut(s)	332
RseI	CAYNNNNRTG	1 cut(s)	131
SatI	GCNGC	6 cut(s)	6, 222, 490, 714, 723, 726
Sau3AI	GATC	3 cut(s)	19, 813, 842
SchI	GAGTC	1 cut(s)	269
SfaNI	GCATC	1 cut(s)	589
SfcI	CTRYAG	1 cut(s)	99
Sfr274I	CTCGAG	1 cut(s)	498
SlaI	CTCGAG	1 cut(s)	498
SmiMI	CAYNNNNRTG	1 cut(s)	131
SmlI	CTYRAG	1 cut(s)	498
SmoI	CTYRAG	1 cut(s)	498
Sse9I	AATT	2 cut(s)	672, 680
SsiI	CCGC	8 cut(s)	11, 350, 407, 713, 716, 722, 725, 820
SspMI	CTAG	2 cut(s)	390, 729
StyI	CCWWGG	1 cut(s)	584
TaaI	ACNGT	4 cut(s)	176, 650, 881, 893
TaiI	ACGT	2 cut(s)	279, 594
TaqI	TCGA	5 cut(s)	82, 129, 499, 645, 741
TasI	AATT	2 cut(s)	672, 680
TauI	GCSGC	3 cut(s)	716, 725, 728
TfiI	GAWTC	4 cut(s)	84, 289, 540, 642
TscAI	CASTG	3 cut(s)	445, 714, 759
TseFI	GTSAC	2 cut(s)	164, 887
TseI	GCWGC	3 cut(s)	5, 221, 489
Tsp45I	GTSAC	2 cut(s)	164, 887
TspRI	CASTG	3 cut(s)	445, 714, 759
Van91I	CCANNNNNTGG	1 cut(s)	684
XapI	RAATTY	1 cut(s)	680
XhoI	CTCGAG	1 cut(s)	498
XmiI	GTMKAC	1 cut(s)	73
XspI	CTAG	2 cut(s)	390, 729

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.