Rmu_sc0043101.1_g000001

PGAP1-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0043101.1
OG0020444
Physical Location & Seq
Forward (+)
1 .. 949
949 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0043101.1_g000001.1.cds

Sequence Viewer

Length: 576 bp
cgaagacatgaattatttgattataagaaagacggaaatggtgggcctgacaaacttacattcaaacgtgatggtatatcaaaccagaatttttcttctgaagatacgtgctccaatagcccagactctccaaaaagttttggtgaaactcaattagagatattccatcatcggcatgggttgtttattttgcatcttgttgcaacgctcatgtttggcccatcatttgtgacttggttggagagaattgggacggatcatagctttccatgggtcttggattcagctctttccacgggtgtgatccttcatggtatcttcacttcaaatcctcagttcaattccttcctggtttctttccctccaatccgaaacctagaagtgaggatgcatttactgtacctgattgctggatactattcctatctctcttccctggccttggctccatatagagaattttatgtcatggctgctgtaggctatacttcaattggtctgaccctcttacagagatggaacaaggagaagggggatgcccattttgttaaccgaaagcactctcacaggcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00563 ko01100 map00563 map01100
Pfam Domains
Protein Families
PGAP1

Protein Analysis

191

Amino Acids

21.89

Weight (kDa)

8.69

Isoelectric Point (pI)

37.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020444)

Species Orthologous Gene IDs
pyrus_communis pycom111g01470 pycom17g01520
rosa_laevigata RLG00000022258
rosa_multiflora Rmu_sc0043101.1_g000001
rosa_samantha Rh2CG631200 Rh2DG681800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 24
AclWI GGATC 2 cut(s) 264, 298
AcsI RAATTY 2 cut(s) 88, 458
AcuI CTGAAG 1 cut(s) 120
AfaI GTAC 1 cut(s) 401
AfiI CCNNNNNNNGG 1 cut(s) 442
AgsI TTSAA 4 cut(s) 64, 327, 340, 492
AjnI CCWGG 2 cut(s) 348, 435
AleI CACNNNNGTG 1 cut(s) 299
AluBI AGCT 2 cut(s) 264, 287
AluI AGCT 2 cut(s) 264, 287
Alw21I GWGCWC 1 cut(s) 113
AlwI GGATC 2 cut(s) 264, 298
AlwNI CAGNNNCTG 1 cut(s) 573
AoxI GGCC 3 cut(s) 44, 217, 438
ApeKI GCWGC 1 cut(s) 473
ApoI RAATTY 2 cut(s) 88, 458
AspS9I GGNCC 2 cut(s) 44, 218
AsuHPI GGTGA 1 cut(s) 155
BarI GAAGNNNNNNTAC 2 cut(s) 307, 339
BbsI GAAGAC 1 cut(s) 10
Bbv12I GWGCWC 1 cut(s) 113
BbvI GCAGC 1 cut(s) 460
BccI CCATC 4 cut(s) 65, 174, 229, 510
BciT130I CCWGG 2 cut(s) 350, 437
BciVI GTATCC 1 cut(s) 407
BfaI CTAG 1 cut(s) 377
BfmI CTRYAG 1 cut(s) 477
BfuI GTATCC 1 cut(s) 407
BisI GCNGC 1 cut(s) 474
BlsI GCNGC 1 cut(s) 475
Bme1390I CCNGG 2 cut(s) 350, 437
BmgT120I GGNCC 2 cut(s) 44, 218
BmiI GGNNCC 1 cut(s) 447
BmrFI CCNGG 2 cut(s) 350, 437
BmsI GCATC 3 cut(s) 202, 378, 526
BpiI GAAGAC 1 cut(s) 10
BsaAI YACGTR 1 cut(s) 108
BsaJI CCNNGG 4 cut(s) 269, 294, 435, 441
Bsc4I CCNNNNNNNGG 1 cut(s) 442
BseBI CCWGG 2 cut(s) 350, 437
BseDI CCNNGG 4 cut(s) 269, 294, 435, 441
BseGI GGATG 2 cut(s) 393, 541
BseLI CCNNNNNNNGG 1 cut(s) 442
BseMII CTCAG 1 cut(s) 347
BseXI GCAGC 1 cut(s) 460
BshFI GGCC 3 cut(s) 46, 219, 440
BsiHKAI GWGCWC 1 cut(s) 113
BslFI GGGAC 1 cut(s) 265
BslI CCNNNNNNNGG 1 cut(s) 442
BsmFI GGGAC 1 cut(s) 265
BsnI GGCC 3 cut(s) 46, 219, 440
Bsp1286I GDGCHC 1 cut(s) 113
Bsp143I GATC 2 cut(s) 256, 303
Bsp19I CCATGG 1 cut(s) 269
BspANI GGCC 3 cut(s) 46, 219, 440
BspCNI CTCAG 1 cut(s) 346
BspLI GGNNCC 1 cut(s) 447
BspPI GGATC 2 cut(s) 264, 298
BssECI CCNNGG 4 cut(s) 269, 294, 435, 441
BssMI GATC 2 cut(s) 256, 303
BssT1I CCWWGG 2 cut(s) 269, 441
Bst2UI CCWGG 2 cut(s) 350, 437
Bst4CI ACNGT 1 cut(s) 399
Bst6I CTCTTC 1 cut(s) 436
BstBAI YACGTR 1 cut(s) 108
BstDEI CTNAG 1 cut(s) 333
BstDSI CCRYGG 2 cut(s) 269, 294
BstF5I GGATG 2 cut(s) 393, 541
BstKTI GATC 2 cut(s) 259, 306
BstMBI GATC 2 cut(s) 256, 303
BstMWI GCNNNNNNNGC 1 cut(s) 117
BstNI CCWGG 2 cut(s) 350, 437
BstSCI CCNGG 2 cut(s) 348, 435
BstSFI CTRYAG 1 cut(s) 477
BstV1I GCAGC 1 cut(s) 460
BstV2I GAAGAC 1 cut(s) 10
BsuI GTATCC 1 cut(s) 407
BsuRI GGCC 3 cut(s) 46, 219, 440
BtgI CCRYGG 2 cut(s) 269, 294
BtsCI GGATG 2 cut(s) 393, 541
BtsIMutI CAGTG 1 cut(s) 571
CaiI CAGNNNCTG 1 cut(s) 573
Cfr13I GGNCC 2 cut(s) 44, 218
Csp6I GTAC 1 cut(s) 400
CviAII CATG 6 cut(s) 8, 176, 211, 270, 311, 469
CviJI RGCY 9 cut(s) 46, 120, 219, 264, 287, 440, 446, 473, 483
CviKI_1 RGCY 9 cut(s) 46, 120, 219, 264, 287, 440, 446, 473, 483
CviQI GTAC 1 cut(s) 400
DdeI CTNAG 1 cut(s) 333
DpnI GATC 2 cut(s) 258, 305
DpnII GATC 2 cut(s) 256, 303
Eam1104I CTCTTC 1 cut(s) 436
EarI CTCTTC 1 cut(s) 436
Eco130I CCWWGG 2 cut(s) 269, 441
Eco57I CTGAAG 1 cut(s) 120
EcoRII CCWGG 2 cut(s) 348, 435
EcoT14I CCWWGG 2 cut(s) 269, 441
EcoT22I ATGCAT 1 cut(s) 393
ErhI CCWWGG 2 cut(s) 269, 441
FaeI CATG 6 cut(s) 11, 179, 214, 273, 314, 472
FaqI GGGAC 1 cut(s) 265
FatI CATG 6 cut(s) 7, 175, 210, 269, 310, 468
Fnu4HI GCNGC 1 cut(s) 474
FokI GGATG 2 cut(s) 400, 548
Fsp4HI GCNGC 1 cut(s) 474
FspBI CTAG 1 cut(s) 377
GluI GCNGC 1 cut(s) 474
HaeIII GGCC 3 cut(s) 46, 219, 440
Hin1II CATG 6 cut(s) 11, 179, 214, 273, 314, 472
HincII GTYRAC 1 cut(s) 550
HindII GTYRAC 1 cut(s) 550
HinfI GANTC 2 cut(s) 125, 281
HpaI GTTAAC 1 cut(s) 550
HphI GGTGA 1 cut(s) 155
Hpy166II GTNNAC 1 cut(s) 550
Hpy188I TCNGA 3 cut(s) 100, 371, 501
Hpy8I GTNNAC 1 cut(s) 550
HpyAV CCTTC 3 cut(s) 317, 355, 523
HpyCH4III ACNGT 1 cut(s) 399
HpyCH4IV ACGT 2 cut(s) 67, 107
HpyCH4V TGCA 3 cut(s) 193, 203, 391
HpyF10VI GCNNNNNNNGC 1 cut(s) 117
HpyF3I CTNAG 1 cut(s) 333
HpySE526I ACGT 2 cut(s) 67, 107
Hsp92II CATG 6 cut(s) 11, 179, 214, 273, 314, 472
KspAI GTTAAC 1 cut(s) 550
Kzo9I GATC 2 cut(s) 256, 303
LmnI GCTCC 2 cut(s) 116, 451
Lsp1109I GCAGC 1 cut(s) 460
LweI GCATC 3 cut(s) 202, 378, 526
MaeI CTAG 1 cut(s) 377
MaeII ACGT 2 cut(s) 67, 107
MaeIII GTNAC 1 cut(s) 229
MalI GATC 2 cut(s) 258, 305
MboI GATC 2 cut(s) 256, 303
MboII GAAGA 5 cut(s) 15, 87, 113, 310, 423
MfeI CAATTG 1 cut(s) 492
MhlI GDGCHC 1 cut(s) 113
MluCI AATT 7 cut(s) 11, 88, 152, 246, 340, 458, 492
MlyI GAGTC 1 cut(s) 119
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 4 cut(s) 342, 372, 378, 515
Mph1103I ATGCAT 1 cut(s) 393
MseI TTAA 1 cut(s) 549
MslI CAYNNNNRTG 2 cut(s) 174, 299
MspR9I CCNGG 2 cut(s) 350, 437
MunI CAATTG 1 cut(s) 492
MvaI CCWGG 2 cut(s) 350, 437
MwoI GCNNNNNNNGC 1 cut(s) 117
NcoI CCATGG 1 cut(s) 269
NdeII GATC 2 cut(s) 256, 303
NlaIII CATG 6 cut(s) 11, 179, 214, 273, 314, 472
NlaIV GGNNCC 1 cut(s) 447
NmuCI GTSAC 1 cut(s) 229
NsiI ATGCAT 1 cut(s) 393
OliI CACNNNNGTG 1 cut(s) 299
PfeI GAWTC 1 cut(s) 281
PkrI GCNGC 1 cut(s) 475
PleI GAGTC 1 cut(s) 119
PpsI GAGTC 1 cut(s) 119
Ppu21I YACGTR 1 cut(s) 108
PsiI TTATAA 1 cut(s) 24
Psp6I CCWGG 2 cut(s) 348, 435
PspGI CCWGG 2 cut(s) 348, 435
PspN4I GGNNCC 1 cut(s) 447
PspPI GGNCC 2 cut(s) 44, 218
PstNI CAGNNNCTG 1 cut(s) 573
RsaI GTAC 1 cut(s) 401
RsaNI GTAC 1 cut(s) 400
RseI CAYNNNNRTG 2 cut(s) 174, 299
SaqAI TTAA 1 cut(s) 549
SatI GCNGC 1 cut(s) 474
Sau3AI GATC 2 cut(s) 256, 303
Sau96I GGNCC 2 cut(s) 44, 218
SchI GAGTC 1 cut(s) 119
ScrFI CCNGG 2 cut(s) 350, 437
SduI GDGCHC 1 cut(s) 113
SetI ASST 6 cut(s) 70, 110, 266, 289, 378, 405
SfaNI GCATC 3 cut(s) 202, 378, 526
SfcI CTRYAG 1 cut(s) 477
SmiMI CAYNNNNRTG 2 cut(s) 174, 299
Sse9I AATT 7 cut(s) 11, 88, 152, 246, 340, 458, 492
SspMI CTAG 1 cut(s) 377
StyD4I CCNGG 2 cut(s) 348, 435
StyI CCWWGG 2 cut(s) 269, 441
TaaI ACNGT 1 cut(s) 399
TaiI ACGT 2 cut(s) 70, 110
TasI AATT 7 cut(s) 11, 88, 152, 246, 340, 458, 492
TfiI GAWTC 1 cut(s) 281
Tru1I TTAA 1 cut(s) 549
Tru9I TTAA 1 cut(s) 549
TseFI GTSAC 1 cut(s) 229
TseI GCWGC 1 cut(s) 473
Tsp45I GTSAC 1 cut(s) 229
TspDTI ATGAA 2 cut(s) 24, 299
TspGWI ACGGA 2 cut(s) 48, 269
XapI RAATTY 2 cut(s) 88, 458
XcmI CCANNNNNNNNNTGG 1 cut(s) 173
XspI CTAG 1 cut(s) 377
Zsp2I ATGCAT 1 cut(s) 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.