Rmu_ssc0000182.1_g000004

Kelch

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000182.1
Physical Location & Seq
Reverse (-)
18099 .. 19612
1514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000182.1_g000004.1.cds

Sequence Viewer

Length: 1125 bp
atgggttctctcccatctccaccaagaccctcttctccaccaccatcaccaactcattctctgtccaactacagagtctgtgccacattttgcttgagagagccctcacccaacttgaacatatccaattggatcgaaatctacgacccatcaaccaactcttggactcatgtcacctcaatccctggccttgttgagaaccacatcctgaaaggtttctctatggtctcaatgggtgactcactttacataattggtggtcggttgtgccacaaggagctctctcacacttcggatgagtgcagctcgcttgtggatatggaagttcaagtctcatcatcggtgttgcgttataatgttgcgactgatcaatggtccacttgtgcaccacttggtgtagccaggtgtgatttcgcctgcacggtttccgataacaaaatctacgtggcgggtggaaagaccacgctggcttgtgcgagaggaatttcgtcggctgagctgtacgaccctgagctagacaagtggattcatatgccaaacatgagcacattgaggtacaagtgcgttggtgtcacatggcaaaacaaaatctacattctgggtggatttgcagagccagtgaggaaaaactcagacgtgcctcctataatggtgcgcagctctgctgaggtttatgacacacaaacaaagaaatgggaactgataattggaatgtggcaattggatgtaccaccaaatcaaattgttgatgtgggtgggaggctattcagttctggggattgcttcaagcaatggaagggtcatattgaatcatatgatggtgaactcaacatatggaatgaggttgatgggtctcatctccacagtttaaactcactgatttcatcagataacgaaatgtgggcacatagccaaaggcgttacctaacgatggcacccatcggagatcacttgtattttttggctattcatggactaatggacaacgatttgccgagaacaatgtcgattgtccatagattcgacacttctgctacgagtaacaattggacaagcatggagccgatggaggaggacagggagaaagagctttgtggacatgcttgtgttgttcatctttcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

374

Amino Acids

41.82

Weight (kDa)

5.55

Isoelectric Point (pI)

52.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015578)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 354
Acc16I TGCGCA 1 cut(s) 656
AccB1I GGYRCC 1 cut(s) 934
AccB7I CCANNNNNTGG 1 cut(s) 162
AciI CCGC 1 cut(s) 449
AclWI GGATC 1 cut(s) 140
AcsI RAATTY 1 cut(s) 483
AdeI CACNNNGTG 1 cut(s) 395
AfaI GTAC 3 cut(s) 503, 557, 729
AfiI CCNNNNNNNGG 2 cut(s) 162, 931
AgsI TTSAA 4 cut(s) 118, 329, 787, 809
AjiI CACGTC 1 cut(s) 637
AjnI CCWGG 2 cut(s) 184, 401
AjuI GAANNNNNNNTTGG 4 cut(s) 16, 48, 690, 722
AluBI AGCT 6 cut(s) 280, 306, 499, 514, 660, 1090
AluI AGCT 6 cut(s) 280, 306, 499, 514, 660, 1090
Alw21I GWGCWC 3 cut(s) 282, 388, 548
Alw26I GTCTC 3 cut(s) 232, 337, 858
Alw44I GTGCAC 1 cut(s) 384
AlwI GGATC 1 cut(s) 140
AlwNI CAGNNNCTG 1 cut(s) 78
AoxI GGCC 1 cut(s) 187
ApaLI GTGCAC 1 cut(s) 384
ApeKI GCWGC 2 cut(s) 303, 657
ApoI RAATTY 1 cut(s) 483
Asp700I GAANNNNTTC 1 cut(s) 215
AspLEI GCGC 1 cut(s) 657
AspS9I GGNCC 1 cut(s) 375
AsuHPI GGTGA 5 cut(s) 39, 99, 166, 248, 833
AvaII GGWCC 1 cut(s) 375
BaeGI GKGCMC 2 cut(s) 388, 907
BanI GGYRCC 1 cut(s) 934
BanII GRGCYC 2 cut(s) 105, 282
Bbv12I GWGCWC 3 cut(s) 282, 388, 548
BbvCI CCTCAGC 1 cut(s) 666
BbvI GCAGC 2 cut(s) 315, 669
BccI CCATC 8 cut(s) 22, 52, 157, 812, 842, 925, 947, 1060
BcgI CGANNNNNNTGC 2 cut(s) 1013, 1047
BciT130I CCWGG 2 cut(s) 186, 403
BclI TGATCA 1 cut(s) 367
BcoDI GTCTC 3 cut(s) 232, 337, 858
BfaI CTAG 1 cut(s) 515
BfmI CTRYAG 1 cut(s) 70
BisI GCNGC 2 cut(s) 304, 658
BlpI GCTNAGC 1 cut(s) 495
BlsI GCNGC 2 cut(s) 305, 659
Bme1390I CCNGG 2 cut(s) 186, 403
Bme18I GGWCC 1 cut(s) 375
BmgBI CACGTC 1 cut(s) 637
BmgT120I GGNCC 1 cut(s) 375
BmiI GGNNCC 2 cut(s) 936, 1062
BmrFI CCNGG 2 cut(s) 186, 403
BoxI GACNNNNGTC 1 cut(s) 170
BplI GAGNNNNNCTC 2 cut(s) 290, 322
Bpu10I CCTNAGC 2 cut(s) 510, 666
Bpu1102I GCTNAGC 1 cut(s) 495
BpuEI CTTGAG 1 cut(s) 115
BsaAI YACGTR 1 cut(s) 445
BsaBI GATNNNNATC 1 cut(s) 137
BsaI GGTCTC 2 cut(s) 232, 858
BsaJI CCNNGG 1 cut(s) 184
Bsc4I CCNNNNNNNGG 2 cut(s) 162, 931
Bse1I ACTGG 1 cut(s) 617
Bse3DI GCAATG 1 cut(s) 797
Bse8I GATNNNNATC 1 cut(s) 137
BseBI CCWGG 2 cut(s) 186, 403
BseDI CCNNGG 1 cut(s) 184
BseGI GGATG 3 cut(s) 204, 301, 730
BseJI GATNNNNATC 1 cut(s) 137
BseLI CCNNNNNNNGG 2 cut(s) 162, 931
BseMI GCAATG 1 cut(s) 797
BseMII CTCAG 4 cut(s) 486, 501, 645, 657
BseNI ACTGG 1 cut(s) 617
BseRI GAGGAG 1 cut(s) 1085
BseSI GKGCMC 2 cut(s) 388, 907
BseXI GCAGC 2 cut(s) 315, 669
BsgI GTGCAG 2 cut(s) 322, 403
BshFI GGCC 1 cut(s) 189
BshNI GGYRCC 1 cut(s) 934
BsiHKAI GWGCWC 3 cut(s) 282, 388, 548
BslI CCNNNNNNNGG 2 cut(s) 162, 931
BsmAI GTCTC 3 cut(s) 232, 337, 858
BsnI GGCC 1 cut(s) 189
Bso31I GGTCTC 2 cut(s) 232, 858
Bsp1286I GDGCHC 5 cut(s) 105, 282, 388, 548, 907
Bsp143I GATC 3 cut(s) 132, 367, 946
Bsp1720I GCTNAGC 1 cut(s) 495
BspACI CCGC 1 cut(s) 449
BspANI GGCC 1 cut(s) 189
BspCNI CTCAG 4 cut(s) 487, 502, 644, 658
BspLI GGNNCC 2 cut(s) 936, 1062
BspPI GGATC 1 cut(s) 140
BspT107I GGYRCC 1 cut(s) 934
BspTNI GGTCTC 2 cut(s) 232, 858
BsrDI GCAATG 1 cut(s) 797
BsrI ACTGG 1 cut(s) 617
BssECI CCNNGG 1 cut(s) 184
BssMI GATC 3 cut(s) 132, 367, 946
Bst2UI CCWGG 2 cut(s) 186, 403
Bst4CI ACNGT 2 cut(s) 424, 866
Bst6I CTCTTC 1 cut(s) 37
BstBAI YACGTR 1 cut(s) 445
BstC8I GCNNGC 3 cut(s) 308, 418, 468
BstDEI CTNAG 5 cut(s) 495, 510, 631, 666, 1122
BstF5I GGATG 3 cut(s) 204, 301, 730
BstHHI GCGC 1 cut(s) 657
BstKTI GATC 3 cut(s) 135, 370, 949
BstMAI GTCTC 3 cut(s) 232, 337, 858
BstMBI GATC 3 cut(s) 132, 367, 946
BstNI CCWGG 2 cut(s) 186, 403
BstNSI RCATGY 1 cut(s) 1103
BstPAI GACNNNNGTC 1 cut(s) 170
BstSCI CCNGG 2 cut(s) 184, 401
BstSFI CTRYAG 1 cut(s) 70
BstSLI GKGCMC 2 cut(s) 388, 907
BstV1I GCAGC 2 cut(s) 315, 669
BsuRI GGCC 1 cut(s) 189
BtrI CACGTC 1 cut(s) 637
BtsCI GGATG 3 cut(s) 204, 301, 730
BtsIMutI CAGTG 2 cut(s) 624, 875
Cac8I GCNNGC 3 cut(s) 308, 418, 468
CaiI CAGNNNCTG 1 cut(s) 78
CfoI GCGC 1 cut(s) 657
Cfr13I GGNCC 1 cut(s) 375
Csp6I GTAC 3 cut(s) 502, 556, 728
CviAII CATG 6 cut(s) 170, 541, 576, 971, 1057, 1100
CviQI GTAC 3 cut(s) 502, 556, 728
DdeI CTNAG 5 cut(s) 495, 510, 631, 666, 1122
DpnI GATC 3 cut(s) 134, 369, 948
DpnII GATC 3 cut(s) 132, 367, 946
DraI TTTAAA 1 cut(s) 870
DraIII CACNNNGTG 1 cut(s) 395
Eam1104I CTCTTC 1 cut(s) 37
EarI CTCTTC 1 cut(s) 37
Ecl136II GAGCTC 1 cut(s) 280
Eco24I GRGCYC 2 cut(s) 105, 282
Eco31I GGTCTC 2 cut(s) 232, 858
Eco47I GGWCC 1 cut(s) 375
Eco53kI GAGCTC 1 cut(s) 280
EcoICRI GAGCTC 1 cut(s) 280
EcoRII CCWGG 2 cut(s) 184, 401
EcoT38I GRGCYC 2 cut(s) 105, 282
FaeI CATG 6 cut(s) 173, 544, 579, 974, 1060, 1103
FalI AAGNNNNNCTT 2 cut(s) 16, 48
FatI CATG 6 cut(s) 169, 540, 575, 970, 1056, 1099
FauI CCCGC 1 cut(s) 442
FauNDI CATATG 3 cut(s) 531, 814, 833
FbaI TGATCA 1 cut(s) 367
Fnu4HI GCNGC 2 cut(s) 304, 658
FokI GGATG 3 cut(s) 191, 308, 737
FriOI GRGCYC 2 cut(s) 105, 282
Fsp4HI GCNGC 2 cut(s) 304, 658
FspBI CTAG 1 cut(s) 515
FspI TGCGCA 1 cut(s) 656
GlaI GCGC 1 cut(s) 656
GluI GCNGC 2 cut(s) 304, 658
HaeIII GGCC 1 cut(s) 189
HhaI GCGC 1 cut(s) 657
Hin1II CATG 6 cut(s) 173, 544, 579, 974, 1060, 1103
Hin6I GCGC 1 cut(s) 655
HinP1I GCGC 1 cut(s) 655
HinfI GANTC 6 cut(s) 75, 166, 239, 526, 809, 1020
HphI GGTGA 5 cut(s) 39, 99, 166, 248, 833
Hpy166II GTNNAC 4 cut(s) 378, 386, 824, 1097
Hpy188I TCNGA 5 cut(s) 295, 430, 634, 889, 944
Hpy188III TCNNGA 1 cut(s) 208
Hpy8I GTNNAC 4 cut(s) 378, 386, 824, 1097
Hpy99I CGWCG 1 cut(s) 493
HpyAV CCTTC 1 cut(s) 790
HpyCH4III ACNGT 2 cut(s) 424, 866
HpyCH4IV ACGT 2 cut(s) 444, 636
HpyCH4V TGCA 4 cut(s) 303, 386, 420, 611
HpyF3I CTNAG 5 cut(s) 495, 510, 631, 666, 1122
HpySE526I ACGT 2 cut(s) 444, 636
Hsp92II CATG 6 cut(s) 173, 544, 579, 974, 1060, 1103
HspAI GCGC 1 cut(s) 655
Ksp22I TGATCA 1 cut(s) 367
Kzo9I GATC 3 cut(s) 132, 367, 946
LmnI GCTCC 2 cut(s) 277, 1060
Lsp1109I GCAGC 2 cut(s) 315, 669
MaeI CTAG 1 cut(s) 515
MaeII ACGT 2 cut(s) 444, 636
MaeIII GTNAC 5 cut(s) 172, 236, 571, 920, 1040
MalI GATC 3 cut(s) 134, 369, 948
MboI GATC 3 cut(s) 132, 367, 946
MboII GAAGA 1 cut(s) 24
MfeI CAATTG 3 cut(s) 127, 719, 1045
MhlI GDGCHC 5 cut(s) 105, 282, 388, 548, 907
MluCI AATT 7 cut(s) 127, 252, 483, 705, 719, 741, 1045
MlyI GAGTC 3 cut(s) 84, 160, 233
MmeI TCCRAC 1 cut(s) 90
MroXI GAANNNNTTC 1 cut(s) 215
MseI TTAA 1 cut(s) 869
MslI CAYNNNNRTG 1 cut(s) 1104
MspR9I CCNGG 2 cut(s) 186, 403
MssI GTTTAAAC 1 cut(s) 870
MunI CAATTG 3 cut(s) 127, 719, 1045
MvaI CCWGG 2 cut(s) 186, 403
NdeI CATATG 3 cut(s) 531, 814, 833
NdeII GATC 3 cut(s) 132, 367, 946
NlaIII CATG 6 cut(s) 173, 544, 579, 974, 1060, 1103
NlaIV GGNNCC 2 cut(s) 936, 1062
NmeAIII GCCGAG 1 cut(s) 1020
NmuCI GTSAC 3 cut(s) 172, 236, 571
NsbI TGCGCA 1 cut(s) 656
NspI RCATGY 1 cut(s) 1103
PcsI WCGNNNNNNNCGW 1 cut(s) 141
PdmI GAANNNNTTC 1 cut(s) 215
PfeI GAWTC 3 cut(s) 526, 809, 1020
PflMI CCANNNNNTGG 1 cut(s) 162
PkrI GCNGC 2 cut(s) 305, 659
PleI GAGTC 3 cut(s) 83, 160, 233
PmeI GTTTAAAC 1 cut(s) 870
PpsI GAGTC 3 cut(s) 83, 160, 233
Ppu21I YACGTR 1 cut(s) 445
PshAI GACNNNNGTC 1 cut(s) 170
PsiI TTATAA 1 cut(s) 354
Psp124BI GAGCTC 1 cut(s) 282
Psp6I CCWGG 2 cut(s) 184, 401
PspGI CCWGG 2 cut(s) 184, 401
PspN4I GGNNCC 2 cut(s) 936, 1062
PspPI GGNCC 1 cut(s) 375
PstNI CAGNNNCTG 1 cut(s) 78
RsaI GTAC 3 cut(s) 503, 557, 729
RsaNI GTAC 3 cut(s) 502, 556, 728
RseI CAYNNNNRTG 1 cut(s) 1104
SacI GAGCTC 1 cut(s) 282
SaqAI TTAA 1 cut(s) 869
SatI GCNGC 2 cut(s) 304, 658
Sau3AI GATC 3 cut(s) 132, 367, 946
Sau96I GGNCC 1 cut(s) 375
SchI GAGTC 3 cut(s) 84, 160, 233
ScrFI CCNGG 2 cut(s) 186, 403
SduI GDGCHC 5 cut(s) 105, 282, 388, 548, 907
SfcI CTRYAG 1 cut(s) 70
SinI GGWCC 1 cut(s) 375
SmiMI CAYNNNNRTG 1 cut(s) 1104
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 7 cut(s) 127, 252, 483, 705, 719, 741, 1045
SsiI CCGC 1 cut(s) 449
SspMI CTAG 1 cut(s) 515
SstI GAGCTC 1 cut(s) 282
StyD4I CCNGG 2 cut(s) 184, 401
TaaI ACNGT 2 cut(s) 424, 866
TaiI ACGT 2 cut(s) 447, 639
TaqI TCGA 3 cut(s) 135, 1007, 1023
TasI AATT 7 cut(s) 127, 252, 483, 705, 719, 741, 1045
TfiI GAWTC 3 cut(s) 526, 809, 1020
Tru1I TTAA 1 cut(s) 869
Tru9I TTAA 1 cut(s) 869
TscAI CASTG 2 cut(s) 624, 882
TseFI GTSAC 3 cut(s) 172, 236, 571
TseI GCWGC 2 cut(s) 303, 657
Tsp45I GTSAC 3 cut(s) 172, 236, 571
TspDTI ATGAA 4 cut(s) 518, 873, 959, 1103
TspRI CASTG 2 cut(s) 624, 882
Van91I CCANNNNNTGG 1 cut(s) 162
VneI GTGCAC 1 cut(s) 384
VpaK11BI GGWCC 1 cut(s) 375
XapI RAATTY 1 cut(s) 483
XceI RCATGY 1 cut(s) 1103
XmnI GAANNNNTTC 1 cut(s) 215
XspI CTAG 1 cut(s) 515
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.