Rmu_ssc0000326.1_g000003

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000326.1
Physical Location & Seq
Reverse (-)
29401 .. 31825
2425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000326.1_g000003.1.cds

Sequence Viewer

Length: 495 bp
atgtcaaagcgaatttgggtgaggcgaaatctcttcaaggtgaatcttggtgatgtgaaacctctcaaggaggatttggtttgcaacttcttcaggaagccaacaacaaagagaaatttcagaaagcatacttctgaagctgaggacgatgaggaatcaaattctgggagtgcggtattaccaagtcaaagaaaagctgcaaagactgatggcaagttgtttttttatagtggaccctctacgagctctgcatctgataatgggaaagtaatccttgagtttaagtcttcaaaagaaatccgatcggaggaggccttgaagggaaccgggaaaagcacaggcaatgaaaaactgtataaagggctccatggatatactgatcacaaggctgggtttcgtagagagctaacagtggccagtgagaaagcgggaggttcccatgggcctctcagggcttctgctcacatcagggcttccaggcgatttgattattag

Protein Analysis

164

Amino Acids

18.33

Weight (kDa)

9.96

Isoelectric Point (pI)

44.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019391)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 173, 428
AcoI YGGCCR 1 cut(s) 414
AcsI RAATTY 3 cut(s) 12, 115, 160
AcuI CTGAAG 2 cut(s) 76, 156
AfiI CCNNNNNNNGG 1 cut(s) 307
AgsI TTSAA 3 cut(s) 37, 291, 319
AjnI CCWGG 1 cut(s) 476
AluBI AGCT 4 cut(s) 140, 197, 246, 406
AluI AGCT 4 cut(s) 140, 197, 246, 406
Alw21I GWGCWC 1 cut(s) 248
AoxI GGCC 3 cut(s) 312, 414, 443
ApeKI GCWGC 1 cut(s) 197
ApoI RAATTY 3 cut(s) 12, 115, 160
AspS9I GGNCC 2 cut(s) 233, 443
AsuC2I CCSGG 1 cut(s) 328
AsuHPI GGTGA 3 cut(s) 31, 52, 62
AvaII GGWCC 1 cut(s) 233
BalI TGGCCA 1 cut(s) 416
BanII GRGCYC 2 cut(s) 248, 366
BbsI GAAGAC 1 cut(s) 279
Bbv12I GWGCWC 1 cut(s) 248
BbvCI CCTCAGC 1 cut(s) 141
BbvI GCAGC 1 cut(s) 184
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 478
BclI TGATCA 1 cut(s) 379
BcnI CCSGG 1 cut(s) 328
BisI GCNGC 1 cut(s) 198
BlsI GCNGC 1 cut(s) 199
Bme1390I CCNGG 2 cut(s) 328, 478
Bme18I GGWCC 1 cut(s) 233
BmgT120I GGNCC 2 cut(s) 233, 443
BmiI GGNNCC 4 cut(s) 235, 325, 365, 436
BmrFI CCNGG 2 cut(s) 328, 478
BmsI GCATC 1 cut(s) 260
BpiI GAAGAC 1 cut(s) 279
Bpu10I CCTNAGC 1 cut(s) 141
BpuEI CTTGAG 2 cut(s) 50, 296
BpuMI CCSGG 1 cut(s) 328
BsaJI CCNNGG 2 cut(s) 367, 439
Bsc4I CCNNNNNNNGG 1 cut(s) 307
Bse1I ACTGG 1 cut(s) 417
Bse3DI GCAATG 1 cut(s) 349
BseBI CCWGG 1 cut(s) 478
BseDI CCNNGG 2 cut(s) 367, 439
BseLI CCNNNNNNNGG 1 cut(s) 307
BseMI GCAATG 1 cut(s) 349
BseMII CTCAG 2 cut(s) 132, 463
BseNI ACTGG 1 cut(s) 417
BseRI GAGGAG 1 cut(s) 323
BseXI GCAGC 1 cut(s) 184
BseYI CCCAGC 1 cut(s) 389
Bsh1285I CGRYCG 1 cut(s) 305
BshFI GGCC 3 cut(s) 314, 416, 445
BsiEI CGRYCG 1 cut(s) 305
BsiHKAI GWGCWC 1 cut(s) 248
BsiSI CCGG 1 cut(s) 327
BslI CCNNNNNNNGG 1 cut(s) 307
BsnI GGCC 3 cut(s) 314, 416, 445
Bsp1286I GDGCHC 2 cut(s) 248, 366
Bsp143I GATC 2 cut(s) 302, 379
Bsp19I CCATGG 2 cut(s) 367, 439
BspACI CCGC 2 cut(s) 173, 428
BspANI GGCC 3 cut(s) 314, 416, 445
BspCNI CTCAG 2 cut(s) 133, 462
BspLI GGNNCC 4 cut(s) 235, 325, 365, 436
BsrDI GCAATG 1 cut(s) 349
BsrI ACTGG 1 cut(s) 417
BssECI CCNNGG 2 cut(s) 367, 439
BssMI GATC 2 cut(s) 302, 379
BssT1I CCWWGG 2 cut(s) 367, 439
Bst2UI CCWGG 1 cut(s) 478
Bst4CI ACNGT 2 cut(s) 354, 412
Bst6I CTCTTC 1 cut(s) 38
BstDEI CTNAG 2 cut(s) 141, 449
BstDSI CCRYGG 2 cut(s) 367, 439
BstKTI GATC 2 cut(s) 305, 382
BstMBI GATC 2 cut(s) 302, 379
BstMCI CGRYCG 1 cut(s) 305
BstNI CCWGG 1 cut(s) 478
BstSCI CCNGG 2 cut(s) 326, 476
BstV1I GCAGC 1 cut(s) 184
BstV2I GAAGAC 1 cut(s) 279
BsuRI GGCC 3 cut(s) 314, 416, 445
BtgI CCRYGG 2 cut(s) 367, 439
BtsIMutI CAGTG 2 cut(s) 417, 424
Cfr13I GGNCC 2 cut(s) 233, 443
CviAII CATG 2 cut(s) 368, 440
DdeI CTNAG 2 cut(s) 141, 449
DpnI GATC 2 cut(s) 304, 381
DpnII GATC 2 cut(s) 302, 379
EaeI YGGCCR 1 cut(s) 414
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
Ecl136II GAGCTC 1 cut(s) 246
Eco130I CCWWGG 2 cut(s) 367, 439
Eco147I AGGCCT 1 cut(s) 314
Eco24I GRGCYC 2 cut(s) 248, 366
Eco47I GGWCC 1 cut(s) 233
Eco53kI GAGCTC 1 cut(s) 246
Eco57I CTGAAG 2 cut(s) 76, 156
EcoICRI GAGCTC 1 cut(s) 246
EcoRII CCWGG 1 cut(s) 476
EcoT14I CCWWGG 2 cut(s) 367, 439
EcoT38I GRGCYC 2 cut(s) 248, 366
ErhI CCWWGG 2 cut(s) 367, 439
FaeI CATG 2 cut(s) 371, 443
FaiI YATR 6 cut(s) 129, 228, 357, 369, 375, 441
FalI AAGNNNNNCTT 2 cut(s) 258, 290
FatI CATG 2 cut(s) 367, 439
FauI CCCGC 1 cut(s) 421
FbaI TGATCA 1 cut(s) 379
Fnu4HI GCNGC 1 cut(s) 198
FriOI GRGCYC 2 cut(s) 248, 366
Fsp4HI GCNGC 1 cut(s) 198
GluI GCNGC 1 cut(s) 198
GsaI CCCAGC 1 cut(s) 393
HaeIII GGCC 3 cut(s) 314, 416, 445
HapII CCGG 1 cut(s) 327
Hin1II CATG 2 cut(s) 371, 443
HinfI GANTC 2 cut(s) 43, 155
HpaII CCGG 1 cut(s) 327
HphI GGTGA 3 cut(s) 31, 52, 62
Hpy166II GTNNAC 1 cut(s) 233
Hpy188I TCNGA 5 cut(s) 122, 136, 256, 302, 307
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 1 cut(s) 233
HpyAV CCTTC 1 cut(s) 313
HpyCH4III ACNGT 2 cut(s) 354, 412
HpyCH4V TGCA 3 cut(s) 84, 200, 251
HpyF3I CTNAG 2 cut(s) 141, 449
Hsp92II CATG 2 cut(s) 371, 443
Ksp22I TGATCA 1 cut(s) 379
Kzo9I GATC 2 cut(s) 302, 379
LmnI GCTCC 1 cut(s) 369
Lsp1109I GCAGC 1 cut(s) 184
LweI GCATC 1 cut(s) 260
MalI GATC 2 cut(s) 304, 381
MboI GATC 2 cut(s) 302, 379
MboII GAAGA 3 cut(s) 25, 82, 279
MhlI GDGCHC 2 cut(s) 248, 366
MlsI TGGCCA 1 cut(s) 416
MluCI AATT 3 cut(s) 12, 115, 160
MluNI TGGCCA 1 cut(s) 416
Mox20I TGGCCA 1 cut(s) 416
MscI TGGCCA 1 cut(s) 416
MseI TTAA 1 cut(s) 282
Msp20I TGGCCA 1 cut(s) 416
MspI CCGG 1 cut(s) 327
MspR9I CCNGG 2 cut(s) 328, 478
MvaI CCWGG 1 cut(s) 478
NciI CCSGG 1 cut(s) 328
NcoI CCATGG 2 cut(s) 367, 439
NdeII GATC 2 cut(s) 302, 379
NlaIII CATG 2 cut(s) 371, 443
NlaIV GGNNCC 4 cut(s) 235, 325, 365, 436
PceI AGGCCT 1 cut(s) 314
PfeI GAWTC 2 cut(s) 43, 155
PkrI GCNGC 1 cut(s) 199
Ple19I CGATCG 1 cut(s) 305
Psp124BI GAGCTC 1 cut(s) 248
Psp6I CCWGG 1 cut(s) 476
PspFI CCCAGC 1 cut(s) 389
PspGI CCWGG 1 cut(s) 476
PspN4I GGNNCC 4 cut(s) 235, 325, 365, 436
PspPI GGNCC 2 cut(s) 233, 443
PvuI CGATCG 1 cut(s) 305
SacI GAGCTC 1 cut(s) 248
SaqAI TTAA 1 cut(s) 282
SatI GCNGC 1 cut(s) 198
Sau3AI GATC 2 cut(s) 302, 379
Sau96I GGNCC 2 cut(s) 233, 443
ScrFI CCNGG 2 cut(s) 328, 478
SduI GDGCHC 2 cut(s) 248, 366
SetI ASST 7 cut(s) 42, 64, 142, 199, 248, 408, 436
SfaNI GCATC 1 cut(s) 260
SinI GGWCC 1 cut(s) 233
SmlI CTYRAG 2 cut(s) 65, 275
SmoI CTYRAG 2 cut(s) 65, 275
Sse9I AATT 3 cut(s) 12, 115, 160
SseBI AGGCCT 1 cut(s) 314
SsiI CCGC 2 cut(s) 173, 428
SstI GAGCTC 1 cut(s) 248
StuI AGGCCT 1 cut(s) 314
StyD4I CCNGG 2 cut(s) 326, 476
StyI CCWWGG 2 cut(s) 367, 439
TaaI ACNGT 2 cut(s) 354, 412
TasI AATT 3 cut(s) 12, 115, 160
TfiI GAWTC 2 cut(s) 43, 155
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TscAI CASTG 2 cut(s) 417, 424
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 1 cut(s) 360
TspRI CASTG 2 cut(s) 417, 424
VpaK11BI GGWCC 1 cut(s) 233
XapI RAATTY 3 cut(s) 12, 115, 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.