Rh3BG111200

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
9079499 .. 9079848
350 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG111200.1

Sequence Viewer

Length: 273 bp
ATGGCGGATTTCGGTGGAAACGCAGAACCTGGAGAAGTTTGCAACTTCTTCAGGAAGCCAACAACAAAGAGAAATTTCAGAAAGCATACTTCTGAAGCTGAGGACGATGAGGAATCAAATTCTGGGAGTGCGGTATTACCAAGTCAAAGAAAAGCTGCAAAGACTGATGGCAAGTTGTTTTTTTCTAGTGGACCCTCTACGAGCTCTGCATCTGATAATGGGAAAGTAATCCTTGAGTTTAAGTCTTCAAAAGAAATCCGAGTAACACGATAG

Protein Analysis

90

Amino Acids

9.8

Weight (kDa)

8.85

Isoelectric Point (pI)

32.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019391)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 131
AcsI RAATTY 2 cut(s) 73, 118
AcuI CTGAAG 2 cut(s) 34, 114
AgsI TTSAA 1 cut(s) 249
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 3 cut(s) 98, 155, 204
AluI AGCT 3 cut(s) 98, 155, 204
Alw21I GWGCWC 1 cut(s) 206
AlwNI CAGNNNCTG 1 cut(s) 29
ApeKI GCWGC 1 cut(s) 155
ApoI RAATTY 2 cut(s) 73, 118
AspS9I GGNCC 1 cut(s) 191
AvaII GGWCC 1 cut(s) 191
BanII GRGCYC 1 cut(s) 206
BbsI GAAGAC 1 cut(s) 237
Bbv12I GWGCWC 1 cut(s) 206
BbvCI CCTCAGC 1 cut(s) 99
BbvI GCAGC 1 cut(s) 142
BccI CCATC 1 cut(s) 161
BciT130I CCWGG 1 cut(s) 30
BfaI CTAG 1 cut(s) 186
BisI GCNGC 1 cut(s) 156
BlsI GCNGC 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 30
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 1 cut(s) 191
BmiI GGNNCC 1 cut(s) 193
BmrFI CCNGG 1 cut(s) 30
BmsI GCATC 1 cut(s) 218
BpiI GAAGAC 1 cut(s) 237
BpmI CTGGAG 1 cut(s) 51
Bpu10I CCTNAGC 1 cut(s) 99
BpuEI CTTGAG 1 cut(s) 254
BseBI CCWGG 1 cut(s) 30
BseMII CTCAG 1 cut(s) 90
BseXI GCAGC 1 cut(s) 142
BsiHKAI GWGCWC 1 cut(s) 206
Bsp1286I GDGCHC 1 cut(s) 206
BspACI CCGC 2 cut(s) 5, 131
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 193
Bst2UI CCWGG 1 cut(s) 30
BstDEI CTNAG 1 cut(s) 99
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 1 cut(s) 28
BstV1I GCAGC 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 237
CaiI CAGNNNCTG 1 cut(s) 29
Cfr13I GGNCC 1 cut(s) 191
CviJI RGCY 4 cut(s) 58, 98, 155, 204
CviKI_1 RGCY 4 cut(s) 58, 98, 155, 204
DdeI CTNAG 1 cut(s) 99
EciI GGCGGA 1 cut(s) 20
Ecl136II GAGCTC 1 cut(s) 204
Eco24I GRGCYC 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 191
Eco53kI GAGCTC 1 cut(s) 204
Eco57I CTGAAG 2 cut(s) 34, 114
EcoICRI GAGCTC 1 cut(s) 204
EcoRII CCWGG 1 cut(s) 28
EcoT38I GRGCYC 1 cut(s) 206
FaiI YATR 1 cut(s) 87
FalI AAGNNNNNCTT 2 cut(s) 216, 248
Fnu4HI GCNGC 1 cut(s) 156
FriOI GRGCYC 1 cut(s) 206
Fsp4HI GCNGC 1 cut(s) 156
FspBI CTAG 1 cut(s) 186
GluI GCNGC 1 cut(s) 156
GsuI CTGGAG 1 cut(s) 51
HinfI GANTC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 191
Hpy188I TCNGA 4 cut(s) 80, 94, 214, 260
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 191
HpyCH4V TGCA 3 cut(s) 42, 158, 209
HpyF3I CTNAG 1 cut(s) 99
LpnPI CCDG 4 cut(s) 15, 37, 42, 108
Lsp1109I GCAGC 1 cut(s) 142
LweI GCATC 1 cut(s) 218
MaeI CTAG 1 cut(s) 186
MaeIII GTNAC 1 cut(s) 262
MboII GAAGA 2 cut(s) 40, 237
MhlI GDGCHC 1 cut(s) 206
MluCI AATT 2 cut(s) 73, 118
MnlI CCTC 3 cut(s) 94, 103, 205
MseI TTAA 1 cut(s) 240
MspR9I CCNGG 1 cut(s) 30
MvaI CCWGG 1 cut(s) 30
NlaIV GGNNCC 1 cut(s) 193
PfeI GAWTC 1 cut(s) 113
PkrI GCNGC 1 cut(s) 157
Psp124BI GAGCTC 1 cut(s) 206
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 193
PspPI GGNCC 1 cut(s) 191
PstNI CAGNNNCTG 1 cut(s) 29
SacI GAGCTC 1 cut(s) 206
SaqAI TTAA 1 cut(s) 240
SatI GCNGC 1 cut(s) 156
Sau96I GGNCC 1 cut(s) 191
ScrFI CCNGG 1 cut(s) 30
SduI GDGCHC 1 cut(s) 206
SetI ASST 4 cut(s) 31, 100, 157, 206
SfaNI GCATC 1 cut(s) 218
SgeI CNNG 9 cut(s) 41, 42, 64, 135, 153, 184, 198, 213, 245
SinI GGWCC 1 cut(s) 191
SmlI CTYRAG 1 cut(s) 233
SmoI CTYRAG 1 cut(s) 233
Sse9I AATT 2 cut(s) 73, 118
SsiI CCGC 2 cut(s) 5, 131
SspMI CTAG 1 cut(s) 186
SstI GAGCTC 1 cut(s) 206
StyD4I CCNGG 1 cut(s) 28
TasI AATT 2 cut(s) 73, 118
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TseI GCWGC 1 cut(s) 155
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 2 cut(s) 73, 118
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.