Rmu_ssc0000395.1_g000001

The glycine cleavage system catalyzes the degradation of glycine

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000395.1
Physical Location & Seq
Forward (+)
9452 .. 14485
5034 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000395.1_g000001.1.cds

Sequence Viewer

Length: 3144 bp
atggagcgtgctcggcgattggcgagccgggctttcgtgaagcgcttggtttccgaggccaagcagtttcgccagaatgagagctcctctgctctgctggggtcttcctcccctgtcatgtacacaccttcaaggtacgtttcttcattgtcttcattcatgcgcacaaatcccagatcagattcgtcgctaggcaaaactggcattgccgggtcacaacagacccggtccattgccgttgaggccttgaaaaacagtgacaccttccctcgccgccataactcagctaccccagatgagcagaccaaaatggctgaggcttgtgggttcaacagcctcgattctctcatcgatgccaccgtgcccaaatcgattcgtcttgaatcgatgaagttctcaaagttcgatgaggggttgacggagagccaaatgctcgagcacatgaaacgtttggcttccaaaaacaagttgttcaagtcgtatattgggatggggtactataacacttatgttccgcctgtgattttgaggaacataatggagaatccagcttggtacacccagtacactccgtaccaggctgagatttctcagggcaggcttgagtctttgctcaatttccagaccttgatcactgaccttactggccttcccatgtcaaatgcttcattacttgatgagggaaccgccgctgccgaggcaatggccatgtgcaacaatattctgaagggcaagaagaagacttttcttattgctaacaattgtcacccccagactattgatatttgcaagactagagctgacggtttcgatctcaaggtcgtgaccgcggatcttaaggacattgattacaagagcggtgacgtttgtggtgttcttgttcagtatccggggactgagggtgaggtgttggactatggggagtttattaagaatgctcatgctaatggtgtcaaggttgtgatggcctctgatctgttggcattgacacttttgaagccgccgggtgagctgggggcggatattgtggtgggttctgctcagaggtttggtgtgccgatggggtatggaggtcctcatgcagcattcttggccacttctcaagagtacaagaggatgatgccaggaagaatcatcggtgttagtgttgattcttcggggaagcctgcgctgcgtatggccatgcagacaagggagcaacatatccgaagggacaaggctaccagcaacatttgcactgctcaggctttacttgcaaacatggctgctatgtatgctgtttatcatggacctgaaggccttaaaaccatttcccaaagggtgcatggtcttgctggggccttggcagttggattaaagaaacttgggactgaagttcagagccttcccttctttgacactgtcaaggttacggttggtgatgcacatgcaattgctgatgctgctgccaagaatggaatgaacttgagagtactggactcaaaaactatcactgtttcgtttgatgaaacaactaccttggaggatgttgatcaacttttcaaaatttttgctttgggcaagcctgtctcttttactgctgcatctcttgcaccagaagtaaagaccgctatcccttctggactaacaagggagaccccatatcttacccacccaatcttcaactcgtatcatactgagcatgagttgctacgatacattcacaagttgcagacaaaggatctttcattatgccacagcatgattccattgggatcctgtacaatgaaattaaatgcaacaactgaaatgatgccagtgacatggcctaatttctcagacattcatccttttgcccctacagaacaagctgagggttatcaggaaatgttcagagatttgggtgatctattgtgtagcatcactgggtttgattctttctcattgcaacctaatgccggagctgctggagagtatgctggactgatggttattcgggcatatcattttgcaagaggggatcaccaccgcaatgtgtgtattatacctgtttctgcacacggtacaaatcctgctagtgctgccatgtgtggaatgaaaattgtcactattggaactgatgctaagggaaacatcaacattgaagagctgaagaaggctgctgaagcaaacaaggacaacctttcagcttttatggtgacgtatccttcaactcatggagtgtatgaagaaggtattgatgagatctgtaagataattcatgacaatggaggtcaagtatacatggatggagctaacatgaatgcacaggtgggtctgacaagcccgggttggattggagctgatgtctgccatctgaacctccataagacattttgcattccacacggaggcggtggtcctggcatgggtcctattggtgtgaaggctcacttggcaccatacttgccttcccatcctgtggtttctactggtggaattcctgcccccgaaaagtctcagccacttggtaccatctccgctgcaccttggggatctgcacttattttgccaatatcatatacttatatagctatgatgggttccaagggactcactgatgcatcaaagatagcaattctgaatgcaaactacatggcaaagcgcttggagaactattaccccattctcttccggggtgtcaatggaaccgttgcccatgagttcattgttgacttgagaggctttaagaacactgctggaatagagccagaagatgttgccaagcgtctgatggactacggatttcatggaccaacaatgtcatggccagttcctggcactctcatgattgaaccaacagaaagtgaaagcaaggctgagttggacaggttttgcgatgctcttatctccatcagagaagagattggccagatcgagaaaggaaaagctgatattaacaacaacgttctaaagggagctcctcacccaccatcactgctcatgggagacacatggtcaaagccatattcccgggaatatgcagccttcccagcttcgtggctccgttcttcgaagttctggcctaccacaggacgtgttgacaatgtgtatggtgaccgcaacctcatctgcactcttcaaccagagcctgtggaggaaacagcagcagcagccactgcttaa

Protein Analysis

1047

Amino Acids

113.71

Weight (kDa)

6.66

Isoelectric Point (pI)

40.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013112)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 164
Acc65I GGTACC 1 cut(s) 2489
AccB1I GGYRCC 2 cut(s) 2416, 2489
AccB7I CCANNNNNTGG 2 cut(s) 2440, 2795
AccBSI CCGCTC 1 cut(s) 858
AccI GTMKAC 1 cut(s) 2259
AccII CGCG 1 cut(s) 830
AclI AACGTT 2 cut(s) 448, 2925
AclWI GGATC 6 cut(s) 840, 1728, 1749, 1762, 2007, 2521
AcoI YGGCCR 5 cut(s) 705, 1092, 1179, 2786, 2887
AcsI RAATTY 2 cut(s) 1545, 2457
AcuI CTGAAG 5 cut(s) 746, 1314, 1392, 2150, 2163
AfeI AGCGCT 2 cut(s) 44, 2624
AfiI CCNNNNNNNGG 6 cut(s) 1937, 2369, 2387, 2440, 2795, 3050
AflII CTTAAG 1 cut(s) 836
AflIII ACRYGT 1 cut(s) 3055
AhdI GACNNNNNGTC 1 cut(s) 2974
AjiI CACGTC 1 cut(s) 3056
AjnI CCWGG 4 cut(s) 576, 1123, 2380, 2794
AjuI GAANNNNNNNTTGG 2 cut(s) 2396, 2428
Alw21I GWGCWC 4 cut(s) 13, 86, 441, 2941
Alw26I GTCTC 4 cut(s) 1573, 1628, 2481, 2961
AlwI GGATC 6 cut(s) 840, 1728, 1749, 1762, 2007, 2521
AlwNI CAGNNNCTG 3 cut(s) 2795, 3110, 3137
Ama87I CYCGRG 3 cut(s) 434, 2305, 2991
Aor51HI AGCGCT 2 cut(s) 44, 2624
ApoI RAATTY 2 cut(s) 1545, 2457
Asp718I GGTACC 1 cut(s) 2489
AspLEI GCGC 4 cut(s) 45, 165, 1171, 2625
AspS9I GGNCC 7 cut(s) 228, 1073, 1289, 1338, 2378, 2390, 2771
AsuII TTCGAA 1 cut(s) 3032
AvaI CYCGRG 3 cut(s) 434, 2305, 2991
AvaII GGWCC 6 cut(s) 228, 1073, 1289, 2378, 2390, 2771
BaeGI GKGCMC 1 cut(s) 366
BalI TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
BamHI GGATCC 1 cut(s) 1754
BanI GGYRCC 2 cut(s) 2416, 2489
BanII GRGCYC 2 cut(s) 86, 2941
BbsI GAAGAC 3 cut(s) 96, 144, 746
Bbv12I GWGCWC 4 cut(s) 13, 86, 441, 2941
BbvCI CCTCAGC 2 cut(s) 315, 1851
BceAI ACGGC 1 cut(s) 221
BciT130I CCWGG 4 cut(s) 578, 1125, 2382, 2796
BciVI GTATCC 2 cut(s) 897, 2193
BclI TGATCA 2 cut(s) 630, 1531
BcoDI GTCTC 4 cut(s) 1573, 1628, 2481, 2961
BfaI CTAG 3 cut(s) 191, 795, 2055
BfmI CTRYAG 1 cut(s) 1839
BfoI RGCGCY 2 cut(s) 46, 2626
BfrI CTTAAG 1 cut(s) 836
BfuI GTATCC 2 cut(s) 897, 2193
BglI GCCNNNNNGGC 1 cut(s) 242
BglII AGATCT 1 cut(s) 2223
BmcAI AGTACT 1 cut(s) 1473
Bme18I GGWCC 6 cut(s) 228, 1073, 1289, 2378, 2390, 2771
BmeRI GACNNNNNGTC 1 cut(s) 2974
BmeT110I CYCGRG 3 cut(s) 434, 2305, 2991
BmgBI CACGTC 1 cut(s) 3056
BmgT120I GGNCC 7 cut(s) 228, 1073, 1289, 1338, 2378, 2390, 2771
BmiI GGNNCC 9 cut(s) 685, 1339, 1756, 2391, 2418, 2491, 2563, 2668, 3023
BmrI ACTGGG 2 cut(s) 556, 1914
BmuI ACTGGG 2 cut(s) 556, 1914
BpiI GAAGAC 3 cut(s) 96, 144, 746
BplI GAGNNNNNCTC 2 cut(s) 71, 103
BpmI CTGGAG 1 cut(s) 1968
Bpu10I CCTNAGC 4 cut(s) 315, 1242, 1851, 2103
Bpu14I TTCGAA 1 cut(s) 3032
BpuEI CTTGAG 5 cut(s) 623, 800, 1086, 1486, 2716
Bsa29I ATCGAT 3 cut(s) 351, 371, 386
BsaBI GATNNNNATC 1 cut(s) 1530
BsaI GGTCTC 1 cut(s) 1628
BsaXI ACNNNNNCTCC 4 cut(s) 2241, 2271, 2310, 2340
Bsc4I CCNNNNNNNGG 6 cut(s) 1937, 2369, 2387, 2440, 2795, 3050
Bse1I ACTGG 8 cut(s) 205, 562, 649, 1479, 1796, 1909, 2455, 2789
Bse3DI GCAATG 5 cut(s) 204, 231, 708, 1922, 2017
Bse8I GATNNNNATC 1 cut(s) 1530
BseBI CCWGG 4 cut(s) 578, 1125, 2382, 2796
BseCI ATCGAT 3 cut(s) 351, 371, 386
BseGI GGATG 6 cut(s) 495, 1122, 1531, 1825, 2272, 2434
BseJI GATNNNNATC 1 cut(s) 1530
BseLI CCNNNNNNNGG 6 cut(s) 1937, 2369, 2387, 2440, 2795, 3050
BseMI GCAATG 5 cut(s) 204, 231, 708, 1922, 2017
BseNI ACTGG 8 cut(s) 205, 562, 649, 1479, 1796, 1909, 2455, 2789
BseRI GAGGAG 2 cut(s) 76, 2931
BseSI GKGCMC 1 cut(s) 366
BseYI CCCAGC 4 cut(s) 97, 1012, 1334, 3010
BsgI GTGCAG 4 cut(s) 2019, 2487, 2502, 3076
Bsh1236I CGCG 1 cut(s) 830
BshNI GGYRCC 2 cut(s) 2416, 2489
BshVI ATCGAT 3 cut(s) 351, 371, 386
BsiHKAI GWGCWC 4 cut(s) 13, 86, 441, 2941
BsiHKCI CYCGRG 3 cut(s) 434, 2305, 2991
BsiSI CCGG 9 cut(s) 28, 210, 226, 890, 1004, 1938, 2306, 2653, 2992
BslFI GGGAC 4 cut(s) 907, 1226, 1381, 2583
BslI CCNNNNNNNGG 6 cut(s) 1937, 2369, 2387, 2440, 2795, 3050
BsmAI GTCTC 4 cut(s) 1573, 1628, 2481, 2961
BsmFI GGGAC 4 cut(s) 907, 1226, 1381, 2583
BsmI GAATGC 5 cut(s) 940, 1085, 2287, 2358, 2608
Bso31I GGTCTC 1 cut(s) 1628
BsoBI CYCGRG 3 cut(s) 434, 2305, 2991
Bsp119I TTCGAA 1 cut(s) 3032
Bsp1286I GDGCHC 5 cut(s) 13, 86, 366, 441, 2941
Bsp1407I TGTACA 2 cut(s) 120, 1760
BspDI ATCGAT 3 cut(s) 351, 371, 386
BspFNI CGCG 1 cut(s) 830
BspHI TCATGA 2 cut(s) 2239, 2805
BspLI GGNNCC 9 cut(s) 685, 1339, 1756, 2391, 2418, 2491, 2563, 2668, 3023
BspPI GGATC 6 cut(s) 840, 1728, 1749, 1762, 2007, 2521
BspQI GCTCTTC 1 cut(s) 2118
BspT104I TTCGAA 1 cut(s) 3032
BspT107I GGYRCC 2 cut(s) 2416, 2489
BspTI CTTAAG 1 cut(s) 836
BspTNI GGTCTC 1 cut(s) 1628
BsrBI CCGCTC 1 cut(s) 858
BsrDI GCAATG 5 cut(s) 204, 231, 708, 1922, 2017
BsrGI TGTACA 2 cut(s) 120, 1760
BsrI ACTGG 8 cut(s) 205, 562, 649, 1479, 1796, 1909, 2455, 2789
BssNAI GTATAC 1 cut(s) 2260
BssT1I CCWWGG 4 cut(s) 1341, 1518, 2507, 2565
Bst1107I GTATAC 1 cut(s) 2260
Bst2UI CCWGG 4 cut(s) 578, 1125, 2382, 2796
Bst4CI ACNGT 8 cut(s) 257, 361, 806, 1402, 1414, 1495, 2042, 2671
Bst6I CTCTTC 4 cut(s) 2118, 2654, 2874, 3102
BstAFI CTTAAG 1 cut(s) 836
BstAPI GCANNNNNTGC 4 cut(s) 1233, 1589, 1687, 3137
BstAUI TGTACA 2 cut(s) 120, 1760
BstBI TTCGAA 1 cut(s) 3032
BstC8I GCNNGC 5 cut(s) 9, 25, 599, 1167, 1562
BstDSI CCRYGG 1 cut(s) 828
BstEII GGTNACC 1 cut(s) 3074
BstENI CCTNNNNNAGG 1 cut(s) 3048
BstF5I GGATG 6 cut(s) 495, 1122, 1531, 1825, 2272, 2434
BstFNI CGCG 1 cut(s) 830
BstH2I RGCGCY 2 cut(s) 46, 2626
BstHHI GCGC 4 cut(s) 45, 165, 1171, 2625
BstMAI GTCTC 4 cut(s) 1573, 1628, 2481, 2961
BstNI CCWGG 4 cut(s) 578, 1125, 2382, 2796
BstNSI RCATGY 1 cut(s) 1430
BstPI GGTNACC 1 cut(s) 3074
BstSFI CTRYAG 1 cut(s) 1839
BstSLI GKGCMC 1 cut(s) 366
BstUI CGCG 1 cut(s) 830
BstV2I GAAGAC 3 cut(s) 96, 144, 746
BstX2I RGATCY 5 cut(s) 832, 1720, 1754, 2223, 2513
BstXI CCANNNNNNTGG 2 cut(s) 1803, 3018
BstYI RGATCY 5 cut(s) 832, 1720, 1754, 2223, 2513
BstZ17I GTATAC 1 cut(s) 2260
Bsu15I ATCGAT 3 cut(s) 351, 371, 386
BsuI GTATCC 2 cut(s) 897, 2193
BsuTUI ATCGAT 3 cut(s) 351, 371, 386
BtgI CCRYGG 1 cut(s) 828
BtgZI GCGATG 1 cut(s) 2871
BtrI CACGTC 1 cut(s) 3056
BtsCI GGATG 6 cut(s) 495, 1122, 1531, 1825, 2272, 2434
BtsI GCAGTG 4 cut(s) 1236, 2712, 2954, 3135
Cac8I GCNNGC 5 cut(s) 9, 25, 599, 1167, 1562
CaiI CAGNNNCTG 3 cut(s) 2795, 3110, 3137
CciI TCATGA 2 cut(s) 2239, 2805
CfoI GCGC 4 cut(s) 45, 165, 1171, 2625
Cfr13I GGNCC 7 cut(s) 228, 1073, 1289, 1338, 2378, 2390, 2771
Cfr42I CCGCGG 1 cut(s) 831
Cfr9I CCCGGG 2 cut(s) 2305, 2991
ClaI ATCGAT 3 cut(s) 351, 371, 386
CseI GACGC 1 cut(s) 2735
DriI GACNNNNNGTC 1 cut(s) 2974
EaeI YGGCCR 5 cut(s) 705, 1092, 1179, 2786, 2887
Eam1104I CTCTTC 4 cut(s) 2118, 2654, 2874, 3102
Eam1105I GACNNNNNGTC 1 cut(s) 2974
EarI CTCTTC 4 cut(s) 2118, 2654, 2874, 3102
EciI GGCGGA 2 cut(s) 504, 1034
Ecl136II GAGCTC 2 cut(s) 84, 2939
Eco130I CCWWGG 4 cut(s) 1341, 1518, 2507, 2565
Eco147I AGGCCT 2 cut(s) 245, 1299
Eco24I GRGCYC 2 cut(s) 86, 2941
Eco31I GGTCTC 1 cut(s) 1628
Eco47I GGWCC 6 cut(s) 228, 1073, 1289, 2378, 2390, 2771
Eco47III AGCGCT 2 cut(s) 44, 2624
Eco53kI GAGCTC 2 cut(s) 84, 2939
Eco57I CTGAAG 5 cut(s) 746, 1314, 1392, 2150, 2163
Eco88I CYCGRG 3 cut(s) 434, 2305, 2991
Eco91I GGTNACC 1 cut(s) 3074
EcoICRI GAGCTC 2 cut(s) 84, 2939
EcoNI CCTNNNNNAGG 1 cut(s) 3048
EcoO109I RGGNCCY 3 cut(s) 1073, 1338, 2390
EcoO65I GGTNACC 1 cut(s) 3074
EcoRI GAATTC 1 cut(s) 2457
EcoRII CCWGG 4 cut(s) 576, 1123, 2380, 2794
EcoT14I CCWWGG 4 cut(s) 1341, 1518, 2507, 2565
EcoT22I ATGCAT 1 cut(s) 2584
EcoT38I GRGCYC 2 cut(s) 86, 2941
ErhI CCWWGG 4 cut(s) 1341, 1518, 2507, 2565
FalI AAGNNNNNCTT 2 cut(s) 2396, 2428
FaqI GGGAC 4 cut(s) 907, 1226, 1381, 2583
FbaI TGATCA 2 cut(s) 630, 1531
FblI GTMKAC 1 cut(s) 2259
FokI GGATG 6 cut(s) 502, 1129, 1538, 1812, 2279, 2421
FriOI GRGCYC 2 cut(s) 86, 2941
FspAI RTGCGCAY 1 cut(s) 164
FspBI CTAG 3 cut(s) 191, 795, 2055
FspI TGCGCA 1 cut(s) 164
GlaI GCGC 4 cut(s) 44, 164, 1170, 2624
GsaI CCCAGC 4 cut(s) 101, 1016, 1338, 3014
GsuI CTGGAG 1 cut(s) 1968
HaeII RGCGCY 2 cut(s) 46, 2626
HapII CCGG 9 cut(s) 28, 210, 226, 890, 1004, 1938, 2306, 2653, 2992
HgaI GACGC 1 cut(s) 2735
HhaI GCGC 4 cut(s) 45, 165, 1171, 2625
Hin6I GCGC 4 cut(s) 43, 163, 1169, 2623
HinP1I GCGC 4 cut(s) 43, 163, 1169, 2623
HincII GTYRAC 3 cut(s) 417, 2692, 3061
HindII GTYRAC 3 cut(s) 417, 2692, 3061
HpaII CCGG 9 cut(s) 28, 210, 226, 890, 1004, 1938, 2306, 2653, 2992
Hpy166II GTNNAC 7 cut(s) 123, 417, 558, 567, 2260, 2692, 3061
Hpy8I GTNNAC 7 cut(s) 123, 417, 558, 567, 2260, 2692, 3061
Hpy99I CGWCG 1 cut(s) 190
HpyCH4III ACNGT 8 cut(s) 257, 361, 806, 1402, 1414, 1495, 2042, 2671
HpyCH4IV ACGT 6 cut(s) 138, 448, 864, 2180, 2925, 3055
HpySE526I ACGT 6 cut(s) 138, 448, 864, 2180, 2925, 3055
HspAI GCGC 4 cut(s) 43, 163, 1169, 2623
KpnI GGTACC 1 cut(s) 2493
Ksp22I TGATCA 2 cut(s) 630, 1531
KspI CCGCGG 1 cut(s) 831
LguI GCTCTTC 1 cut(s) 2118
LmnI GCTCC 9 cut(s) 4, 89, 1195, 1940, 2270, 2318, 2936, 2944, 3027
MaeI CTAG 3 cut(s) 191, 795, 2055
MaeII ACGT 6 cut(s) 138, 448, 864, 2180, 2925, 3055
MbiI CCGCTC 1 cut(s) 858
MfeI CAATTG 2 cut(s) 760, 1431
MflI RGATCY 5 cut(s) 832, 1720, 1754, 2223, 2513
MhlI GDGCHC 5 cut(s) 13, 86, 366, 441, 2941
MlsI TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
MluNI TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
MlyI GAGTC 3 cut(s) 614, 1472, 2565
MmeI TCCRAC 4 cut(s) 891, 1330, 2291, 2823
Mox20I TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
Mph1103I ATGCAT 1 cut(s) 2584
MscI TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
MseI TTAA 8 cut(s) 837, 930, 1302, 1355, 1772, 2706, 2916, 3142
MslI CAYNNNNRTG 4 cut(s) 945, 2010, 2244, 2804
Msp20I TGGCCA 5 cut(s) 707, 1094, 1181, 2788, 2889
MspA1I CMGCKG 3 cut(s) 692, 830, 2501
MspCI CTTAAG 1 cut(s) 836
MspI CCGG 9 cut(s) 28, 210, 226, 890, 1004, 1938, 2306, 2653, 2992
MunI CAATTG 2 cut(s) 760, 1431
Mva1269I GAATGC 5 cut(s) 940, 1085, 2287, 2358, 2608
MvaI CCWGG 4 cut(s) 578, 1125, 2382, 2796
MvnI CGCG 1 cut(s) 830
NlaIV GGNNCC 9 cut(s) 685, 1339, 1756, 2391, 2418, 2491, 2563, 2668, 3023
NmeAIII GCCGAG 1 cut(s) 721
NmuCI GTSAC 9 cut(s) 213, 257, 764, 823, 860, 1798, 2083, 2176, 3074
NsbI TGCGCA 1 cut(s) 164
NsiI ATGCAT 1 cut(s) 2584
NspI RCATGY 1 cut(s) 1430
NspV TTCGAA 1 cut(s) 3032
PaeR7I CTCGAG 1 cut(s) 434
PagI TCATGA 2 cut(s) 2239, 2805
PceI AGGCCT 2 cut(s) 245, 1299
PciSI GCTCTTC 1 cut(s) 2118
PcsI WCGNNNNNNNCGW 1 cut(s) 357
PctI GAATGC 5 cut(s) 940, 1085, 2287, 2358, 2608
PfeI GAWTC 9 cut(s) 182, 341, 373, 383, 544, 1131, 1151, 1744, 1913
PflFI GACNNNGTC 2 cut(s) 226, 1400
PflMI CCANNNNNTGG 2 cut(s) 2440, 2795
PleI GAGTC 3 cut(s) 613, 1472, 2565
PpsI GAGTC 3 cut(s) 613, 1472, 2565
PpuMI RGGWCCY 2 cut(s) 1073, 2390
Psp124BI GAGCTC 2 cut(s) 86, 2941
Psp1406I AACGTT 2 cut(s) 448, 2925
Psp5II RGGWCCY 2 cut(s) 1073, 2390
Psp6I CCWGG 4 cut(s) 576, 1123, 2380, 2794
PspEI GGTNACC 1 cut(s) 3074
PspFI CCCAGC 4 cut(s) 97, 1012, 1334, 3010
PspGI CCWGG 4 cut(s) 576, 1123, 2380, 2794
PspN4I GGNNCC 9 cut(s) 685, 1339, 1756, 2391, 2418, 2491, 2563, 2668, 3023
PspPI GGNCC 7 cut(s) 228, 1073, 1289, 1338, 2378, 2390, 2771
PspPPI RGGWCCY 2 cut(s) 1073, 2390
PspXI VCTCGAGB 1 cut(s) 434
PstNI CAGNNNCTG 3 cut(s) 2795, 3110, 3137
PsuI RGATCY 5 cut(s) 832, 1720, 1754, 2223, 2513
PsyI GACNNNGTC 2 cut(s) 226, 1400
RseI CAYNNNNRTG 4 cut(s) 945, 2010, 2244, 2804
SacI GAGCTC 2 cut(s) 86, 2941
SacII CCGCGG 1 cut(s) 831
SapI GCTCTTC 1 cut(s) 2118
SaqAI TTAA 8 cut(s) 837, 930, 1302, 1355, 1772, 2706, 2916, 3142
Sau96I GGNCC 7 cut(s) 228, 1073, 1289, 1338, 2378, 2390, 2771
ScaI AGTACT 1 cut(s) 1473
SchI GAGTC 3 cut(s) 614, 1472, 2565
SduI GDGCHC 5 cut(s) 13, 86, 366, 441, 2941
SfcI CTRYAG 1 cut(s) 1839
Sfr274I CTCGAG 1 cut(s) 434
Sfr303I CCGCGG 1 cut(s) 831
SfuI TTCGAA 1 cut(s) 3032
SgrBI CCGCGG 1 cut(s) 831
SinI GGWCC 6 cut(s) 228, 1073, 1289, 2378, 2390, 2771
SlaI CTCGAG 1 cut(s) 434
SmaI CCCGGG 2 cut(s) 2307, 2993
SmiMI CAYNNNNRTG 4 cut(s) 945, 2010, 2244, 2804
SmlI CTYRAG 7 cut(s) 434, 602, 815, 836, 1101, 1465, 2695
SmoI CTYRAG 7 cut(s) 434, 602, 815, 836, 1101, 1465, 2695
SseBI AGGCCT 2 cut(s) 245, 1299
SspI AATATT 1 cut(s) 721
SspMI CTAG 3 cut(s) 191, 795, 2055
SstI GAGCTC 2 cut(s) 86, 2941
StuI AGGCCT 2 cut(s) 245, 1299
StyI CCWWGG 4 cut(s) 1341, 1518, 2507, 2565
TaaI ACNGT 8 cut(s) 257, 361, 806, 1402, 1414, 1495, 2042, 2671
TaiI ACGT 6 cut(s) 141, 451, 867, 2183, 2928, 3058
TaqI TCGA 9 cut(s) 339, 351, 371, 386, 405, 435, 810, 2895, 3032
TatI WGTACW 5 cut(s) 120, 564, 1107, 1471, 1760
TauI GCSGC 3 cut(s) 276, 692, 1003
TfiI GAWTC 9 cut(s) 182, 341, 373, 383, 544, 1131, 1151, 1744, 1913
Tru1I TTAA 8 cut(s) 837, 930, 1302, 1355, 1772, 2706, 2916, 3142
Tru9I TTAA 8 cut(s) 837, 930, 1302, 1355, 1772, 2706, 2916, 3142
TseFI GTSAC 9 cut(s) 213, 257, 764, 823, 860, 1798, 2083, 2176, 3074
Tsp45I GTSAC 9 cut(s) 213, 257, 764, 823, 860, 1798, 2083, 2176, 3074
TspGWI ACGGA 5 cut(s) 434, 561, 2382, 2775, 3014
TspMI CCCGGG 2 cut(s) 2305, 2991
Tth111I GACNNNGTC 2 cut(s) 226, 1400
Van91I CCANNNNNTGG 2 cut(s) 2440, 2795
Vha464I CTTAAG 1 cut(s) 836
VpaK11BI GGWCC 6 cut(s) 228, 1073, 1289, 2378, 2390, 2771
XagI CCTNNNNNAGG 1 cut(s) 3048
XapI RAATTY 2 cut(s) 1545, 2457
XceI RCATGY 1 cut(s) 1430
XcmI CCANNNNNNNNNTGG 3 cut(s) 1322, 2749, 2781
XhoI CTCGAG 1 cut(s) 434
XmaI CCCGGG 2 cut(s) 2305, 2991
XmiI GTMKAC 1 cut(s) 2259
XspI CTAG 3 cut(s) 191, 795, 2055
ZrmI AGTACT 1 cut(s) 1473
Zsp2I ATGCAT 1 cut(s) 2584
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.