Rmu_ssc0000408.1_g000011

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000408.1
Physical Location & Seq
Reverse (-)
54923 .. 55225
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000408.1_g000011.1.cds

Sequence Viewer

Length: 303 bp
atgaggcaaaatctccaaaacatgaggaaaagccccagagtagcagatgagagcatggttaacataggaggcgggaacttggcagtagaattgccaattataagaagatcatcatcccgcggttggaaaggattttcggttatagttagcgttgtgatcctgccattttcggttctttcttgcttctctcagcctcatgttcatggcgctgacggggtttgggcgtcgggtgattttgcgcagataacggagatgaatcatctaatggtaagtgacagcatgcgctatgccatcttgatgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.03

Weight (kDa)

9.18

Isoelectric Point (pI)

55.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 101
Acc16I TGCGCA 1 cut(s) 240
AccII CGCG 1 cut(s) 120
AciI CCGC 3 cut(s) 72, 118, 120
AclWI GGATC 1 cut(s) 151
AcyI GRCGYC 1 cut(s) 224
AfiI CCNNNNNNNGG 1 cut(s) 123
AlwI GGATC 1 cut(s) 151
AspLEI GCGC 3 cut(s) 209, 241, 285
AsuHPI GGTGA 1 cut(s) 242
BccI CCATC 1 cut(s) 299
BfoI RGCGCY 1 cut(s) 210
BsaBI GATNNNNATC 1 cut(s) 112
BsaHI GRCGYC 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 118
Bsc4I CCNNNNNNNGG 1 cut(s) 123
Bse8I GATNNNNATC 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 118
BseGI GGATG 1 cut(s) 113
BseJI GATNNNNATC 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 123
BseMII CTCAG 1 cut(s) 203
Bsh1236I CGCG 1 cut(s) 120
BslI CCNNNNNNNGG 1 cut(s) 123
Bsp143I GATC 2 cut(s) 107, 156
BspACI CCGC 3 cut(s) 72, 118, 120
BspCNI CTCAG 1 cut(s) 202
BspFNI CGCG 1 cut(s) 120
BspPI GGATC 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 118
BssMI GATC 2 cut(s) 107, 156
BssNI GRCGYC 1 cut(s) 224
BstACI GRCGYC 1 cut(s) 224
BstC8I GCNNGC 1 cut(s) 281
BstDEI CTNAG 1 cut(s) 189
BstDSI CCRYGG 1 cut(s) 118
BstF5I GGATG 1 cut(s) 113
BstFNI CGCG 1 cut(s) 120
BstH2I RGCGCY 1 cut(s) 210
BstHHI GCGC 3 cut(s) 209, 241, 285
BstKTI GATC 2 cut(s) 110, 159
BstMBI GATC 2 cut(s) 107, 156
BstNSI RCATGY 1 cut(s) 283
BstUI CGCG 1 cut(s) 120
BtgI CCRYGG 1 cut(s) 118
BtsCI GGATG 1 cut(s) 113
Cac8I GCNNGC 1 cut(s) 281
CfoI GCGC 3 cut(s) 209, 241, 285
Cfr42I CCGCGG 1 cut(s) 121
CseI GACGC 1 cut(s) 213
CviAII CATG 5 cut(s) 22, 55, 197, 203, 280
CviJI RGCY 2 cut(s) 33, 193
CviKI_1 RGCY 2 cut(s) 33, 193
DdeI CTNAG 1 cut(s) 189
DpnI GATC 2 cut(s) 109, 158
DpnII GATC 2 cut(s) 107, 156
FaeI CATG 5 cut(s) 25, 58, 200, 206, 283
FaiI YATR 9 cut(s) 23, 56, 65, 101, 143, 198, 204, 281, 288
FatI CATG 5 cut(s) 21, 54, 196, 202, 279
FauI CCCGC 2 cut(s) 65, 125
FokI GGATG 1 cut(s) 100
FspI TGCGCA 1 cut(s) 240
GlaI GCGC 3 cut(s) 208, 240, 284
HaeII RGCGCY 1 cut(s) 210
HgaI GACGC 1 cut(s) 213
HhaI GCGC 3 cut(s) 209, 241, 285
Hin1I GRCGYC 1 cut(s) 224
Hin1II CATG 5 cut(s) 25, 58, 200, 206, 283
Hin6I GCGC 3 cut(s) 207, 239, 283
HinP1I GCGC 3 cut(s) 207, 239, 283
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HinfI GANTC 1 cut(s) 256
HpaI GTTAAC 1 cut(s) 61
HphI GGTGA 1 cut(s) 242
Hpy166II GTNNAC 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 295
Hpy8I GTNNAC 1 cut(s) 61
Hpy99I CGWCG 1 cut(s) 229
HpyF3I CTNAG 1 cut(s) 189
Hsp92I GRCGYC 1 cut(s) 224
Hsp92II CATG 5 cut(s) 25, 58, 200, 206, 283
HspAI GCGC 3 cut(s) 207, 239, 283
KspAI GTTAAC 1 cut(s) 61
KspI CCGCGG 1 cut(s) 121
Kzo9I GATC 2 cut(s) 107, 156
LpnPI CCDG 2 cut(s) 49, 173
MaeIII GTNAC 1 cut(s) 272
MalI GATC 2 cut(s) 109, 158
MboI GATC 2 cut(s) 107, 156
MboII GAAGA 1 cut(s) 117
MluCI AATT 2 cut(s) 89, 96
MmeI TCCRAC 1 cut(s) 104
MnlI CCTC 3 cut(s) 18, 62, 204
MseI TTAA 1 cut(s) 60
MslI CAYNNNNRTG 2 cut(s) 201, 296
MspA1I CMGCKG 1 cut(s) 120
MvnI CGCG 1 cut(s) 120
NdeII GATC 2 cut(s) 107, 156
NlaIII CATG 5 cut(s) 25, 58, 200, 206, 283
NmuCI GTSAC 1 cut(s) 272
NsbI TGCGCA 1 cut(s) 240
NspI RCATGY 1 cut(s) 283
PaeI GCATGC 1 cut(s) 283
PfeI GAWTC 1 cut(s) 256
PsiI TTATAA 1 cut(s) 101
RseI CAYNNNNRTG 2 cut(s) 201, 296
SacII CCGCGG 1 cut(s) 121
SaqAI TTAA 1 cut(s) 60
Sau3AI GATC 2 cut(s) 107, 156
Sfr303I CCGCGG 1 cut(s) 121
SgrBI CCGCGG 1 cut(s) 121
SmiMI CAYNNNNRTG 2 cut(s) 201, 296
SphI GCATGC 1 cut(s) 283
Sse9I AATT 2 cut(s) 89, 96
SsiI CCGC 3 cut(s) 72, 118, 120
TasI AATT 2 cut(s) 89, 96
TfiI GAWTC 1 cut(s) 256
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
TseFI GTSAC 1 cut(s) 272
Tsp45I GTSAC 1 cut(s) 272
TspDTI ATGAA 2 cut(s) 191, 269
TspGWI ACGGA 1 cut(s) 263
XceI RCATGY 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.