Rh7BG348900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
36363830 .. 36364799
970 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG348900.1

Sequence Viewer

Length: 324 bp
ATGTGGCATATGCTAGCCACAATAAGGCAAAATCTCCAAAACATGAGGAAAAGCCCCAGAGTAGCAGATGAGAGCATGGTTAACATAGGAGGCGGGAACTTGGCAGAAGAATTGCCAATTATAAGAAGATCATCATCTCGCGGTTGGAAGGGATTTTCGGTTATAGTTAGCGTTGTGATCCTGCCATTTTCGGTTCTTTCTTGCTTCTCTCAGCCTCATGTTCATGGCGCTGACGGGGTTTGGGCGTCGGGTGATTTTGCTCAGATAACGGAGATGAATCATCTAATGGTAAGTGACAGCATGCGCTATGCCATCTTGATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

107

Amino Acids

11.92

Weight (kDa)

8.02

Isoelectric Point (pI)

58.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 122
AccII CGCG 1 cut(s) 141
AciI CCGC 2 cut(s) 93, 141
AclWI GGATC 1 cut(s) 172
AcyI GRCGYC 1 cut(s) 245
AfiI CCNNNNNNNGG 1 cut(s) 24
AlwI GGATC 1 cut(s) 172
AspLEI GCGC 2 cut(s) 230, 306
AsuHPI GGTGA 1 cut(s) 263
AsuNHI GCTAGC 1 cut(s) 13
BccI CCATC 1 cut(s) 320
BfaI CTAG 1 cut(s) 14
BfoI RGCGCY 1 cut(s) 231
BmtI GCTAGC 1 cut(s) 17
BsaBI GATNNNNATC 1 cut(s) 133
BsaHI GRCGYC 1 cut(s) 245
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 133
BseJI GATNNNNATC 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 24
BseMII CTCAG 2 cut(s) 224, 275
Bsh1236I CGCG 1 cut(s) 141
BslI CCNNNNNNNGG 1 cut(s) 24
Bsp143I GATC 2 cut(s) 128, 177
BspACI CCGC 2 cut(s) 93, 141
BspCNI CTCAG 2 cut(s) 223, 274
BspFNI CGCG 1 cut(s) 141
BspOI GCTAGC 1 cut(s) 17
BspPI GGATC 1 cut(s) 172
BssMI GATC 2 cut(s) 128, 177
BssNI GRCGYC 1 cut(s) 245
BstACI GRCGYC 1 cut(s) 245
BstC8I GCNNGC 2 cut(s) 15, 302
BstDEI CTNAG 2 cut(s) 210, 261
BstFNI CGCG 1 cut(s) 141
BstH2I RGCGCY 1 cut(s) 231
BstHHI GCGC 2 cut(s) 230, 306
BstKTI GATC 2 cut(s) 131, 180
BstMBI GATC 2 cut(s) 128, 177
BstNSI RCATGY 1 cut(s) 304
BstUI CGCG 1 cut(s) 141
Cac8I GCNNGC 2 cut(s) 15, 302
CfoI GCGC 2 cut(s) 230, 306
CseI GACGC 1 cut(s) 234
CviAII CATG 5 cut(s) 43, 76, 218, 224, 301
CviJI RGCY 3 cut(s) 17, 54, 214
CviKI_1 RGCY 3 cut(s) 17, 54, 214
DdeI CTNAG 2 cut(s) 210, 261
DpnI GATC 2 cut(s) 130, 179
DpnII GATC 2 cut(s) 128, 177
FaeI CATG 5 cut(s) 46, 79, 221, 227, 304
FatI CATG 5 cut(s) 42, 75, 217, 223, 300
FauI CCCGC 1 cut(s) 86
FauNDI CATATG 1 cut(s) 9
FspBI CTAG 1 cut(s) 14
GlaI GCGC 2 cut(s) 229, 305
HaeII RGCGCY 1 cut(s) 231
HgaI GACGC 1 cut(s) 234
HhaI GCGC 2 cut(s) 230, 306
Hin1I GRCGYC 1 cut(s) 245
Hin1II CATG 5 cut(s) 46, 79, 221, 227, 304
Hin6I GCGC 2 cut(s) 228, 304
HinP1I GCGC 2 cut(s) 228, 304
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HinfI GANTC 1 cut(s) 277
HpaI GTTAAC 1 cut(s) 82
HphI GGTGA 1 cut(s) 263
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 264
Hpy188III TCNNGA 1 cut(s) 316
Hpy8I GTNNAC 1 cut(s) 82
Hpy99I CGWCG 1 cut(s) 250
HpyAV CCTTC 1 cut(s) 142
HpyF3I CTNAG 2 cut(s) 210, 261
Hsp92I GRCGYC 1 cut(s) 245
Hsp92II CATG 5 cut(s) 46, 79, 221, 227, 304
HspAI GCGC 2 cut(s) 228, 304
KspAI GTTAAC 1 cut(s) 82
Kzo9I GATC 2 cut(s) 128, 177
LpnPI CCDG 2 cut(s) 70, 194
MaeI CTAG 1 cut(s) 14
MaeIII GTNAC 1 cut(s) 293
MalI GATC 2 cut(s) 130, 179
MboI GATC 2 cut(s) 128, 177
MboII GAAGA 2 cut(s) 119, 138
MluCI AATT 2 cut(s) 110, 117
MmeI TCCRAC 1 cut(s) 125
MnlI CCTC 3 cut(s) 39, 83, 225
MseI TTAA 1 cut(s) 81
MslI CAYNNNNRTG 2 cut(s) 222, 317
MvnI CGCG 1 cut(s) 141
NdeI CATATG 1 cut(s) 9
NdeII GATC 2 cut(s) 128, 177
NheI GCTAGC 1 cut(s) 13
NlaIII CATG 5 cut(s) 46, 79, 221, 227, 304
NmuCI GTSAC 1 cut(s) 293
NspI RCATGY 1 cut(s) 304
PaeI GCATGC 1 cut(s) 304
PfeI GAWTC 1 cut(s) 277
PsiI TTATAA 1 cut(s) 122
RseI CAYNNNNRTG 2 cut(s) 222, 317
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 2 cut(s) 128, 177
SmiMI CAYNNNNRTG 2 cut(s) 222, 317
SphI GCATGC 1 cut(s) 304
Sse9I AATT 2 cut(s) 110, 117
SsiI CCGC 2 cut(s) 93, 141
SspMI CTAG 1 cut(s) 14
TasI AATT 2 cut(s) 110, 117
TfiI GAWTC 1 cut(s) 277
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseFI GTSAC 1 cut(s) 293
Tsp45I GTSAC 1 cut(s) 293
TspDTI ATGAA 2 cut(s) 212, 290
TspGWI ACGGA 1 cut(s) 284
XceI RCATGY 1 cut(s) 304
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.