Rmu_ssc0000455.1_g000001

F-box kelch-repeat protein At1g57790-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000455.1
OG0017680
Physical Location & Seq
Forward (+)
321 .. 1709
1389 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000455.1_g000001.1.cds

Sequence Viewer

Length: 1050 bp
atgtcagttgtagttgccaacaagaaactcaagggagaaatcccacaaccacaaccaccaccatggtctgatcttaaccttgacatattgatttgcatcatgggacgcctttgttatgtggaccagattcattttcgtgctgtttgcaagaattggagactagtttctggtgtgaagcctatagataaactcccttgggttctgacattgaatttcaattgcaagcatgattattatcccataaccctccatgatccatctagctgcattacatatgagcttggtcatgaaatcgatcggtcaagtttgcctgggtttggcaaactacaagtctgtggtgcaggaaagaacggttgctctaggattaaagccacatttggtggtacctctgatctaacatccaaagattgtttgtttttcgcggtgcatgatgttggtgaggatcaagagggaatgaggattagcacttgccgccatggtgatagaaagtggactaaacagtttacagatcgacgtagtagggagatagtaattggtgtgttccatgtcaagggtatcttcttctgtgtcttcaaaagtggaattctaggttcattcaacccaaataccaaaatttggagcttgctgattacttcggaaaacatggatttagtggagttacaaaacctagcagcttttgaagctagtgttgttgagtgtgatggagaggtgtttctagtgtactggaagcgggggtataagccttggcacattttcaggctagattggttgcaaatgaaatgggtgaagcaggttagcttgggtaaaagagtgttatttcttggtgacatctcgttgttgtattctgctgatggtgaaataaaggatttagctgatcgtatctattatcagggtttcaggaaatcttacttctatccaatcaagtccggtattagtaagctccgcagcaatgcattgatacgccagtcatgcatacattatgaggcacgcagcgatcatatgctcagagtttggattgaaccaccaacgctatacagagaggcagcatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box

Protein Analysis

349

Amino Acids

40.07

Weight (kDa)

8.97

Isoelectric Point (pI)

38.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017680)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g05681
prunus_persica Prupe.1G157100_v2.0.a1 Prupe.1G157100_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0454581
rosa_laevigata RLG00000025432
rosa_multiflora Rmu_ssc0000455.1_g000001
rosa_rugosa Rorug03G0000400
rosa_samantha Rh3AG060100 Rh3BG062200 Rh3CG061000 Rh3DG061800
rosa_wichuraiana Rw3G004670

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 781
Acc65I GGTACC 1 cut(s) 383
AccB1I GGYRCC 1 cut(s) 383
AccB7I CCANNNNNTGG 1 cut(s) 615
AccII CGCG 1 cut(s) 422
AciI CCGC 4 cut(s) 422, 472, 730, 943
AclWI GGATC 2 cut(s) 248, 450
AcsI RAATTY 3 cut(s) 211, 582, 612
AcyI GRCGYC 1 cut(s) 106
AfaI GTAC 2 cut(s) 385, 722
AfiI CCNNNNNNNGG 3 cut(s) 317, 550, 615
AgsI TTSAA 6 cut(s) 211, 217, 574, 598, 680, 1019
AhlI ACTAGT 1 cut(s) 160
AjnI CCWGG 1 cut(s) 310
AluBI AGCT 8 cut(s) 264, 280, 621, 674, 683, 798, 872, 940
AluI AGCT 8 cut(s) 264, 280, 621, 674, 683, 798, 872, 940
Alw26I GTCTC 1 cut(s) 151
AlwI GGATC 2 cut(s) 248, 450
ApeKI GCWGC 5 cut(s) 264, 671, 945, 990, 1043
ApoI RAATTY 3 cut(s) 211, 582, 612
ArsI GACNNNNNNTTYG 2 cut(s) 315, 347
Asp718I GGTACC 1 cut(s) 383
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 5 cut(s) 449, 491, 796, 836, 866
AvaII GGWCC 1 cut(s) 121
BaeI ACNNNNGTAYC 2 cut(s) 950, 983
BanI GGYRCC 1 cut(s) 383
BbsI GAAGAC 1 cut(s) 562
BbvI GCAGC 4 cut(s) 251, 683, 957, 1002
BccI CCATC 3 cut(s) 265, 695, 845
BciT130I CCWGG 1 cut(s) 312
BcoDI GTCTC 1 cut(s) 151
BcuI ACTAGT 1 cut(s) 160
BfaI CTAG 8 cut(s) 161, 261, 360, 587, 668, 684, 716, 761
BfmI CTRYAG 1 cut(s) 180
BfuAI ACCTGC 1 cut(s) 781
BisI GCNGC 6 cut(s) 265, 472, 672, 946, 991, 1044
BlsI GCNGC 6 cut(s) 266, 473, 673, 947, 992, 1045
Bme1390I CCNGG 1 cut(s) 312
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmiI GGNNCC 1 cut(s) 385
BmrFI CCNGG 1 cut(s) 312
BmsI GCATC 1 cut(s) 105
BpiI GAAGAC 1 cut(s) 562
BpuEI CTTGAG 1 cut(s) 14
Bsa29I ATCGAT 1 cut(s) 294
BsaBI GATNNNNATC 2 cut(s) 95, 234
BsaHI GRCGYC 1 cut(s) 106
BsaJI CCNNGG 5 cut(s) 62, 194, 311, 475, 743
BsaWI WCCGGW 1 cut(s) 926
Bsc4I CCNNNNNNNGG 3 cut(s) 317, 550, 615
Bse1I ACTGG 2 cut(s) 728, 964
Bse3DI GCAATG 1 cut(s) 955
Bse8I GATNNNNATC 2 cut(s) 95, 234
BseBI CCWGG 1 cut(s) 312
BseCI ATCGAT 1 cut(s) 294
BseDI CCNNGG 5 cut(s) 62, 194, 311, 475, 743
BseGI GGATG 1 cut(s) 398
BseJI GATNNNNATC 2 cut(s) 95, 234
BseLI CCNNNNNNNGG 3 cut(s) 317, 550, 615
BseMI GCAATG 1 cut(s) 955
BseMII CTCAG 1 cut(s) 1018
BseNI ACTGG 2 cut(s) 728, 964
BseXI GCAGC 4 cut(s) 251, 683, 957, 1002
BsgI GTGCAG 1 cut(s) 360
Bsh1236I CGCG 1 cut(s) 422
Bsh1285I CGRYCG 1 cut(s) 298
BshNI GGYRCC 1 cut(s) 383
BshVI ATCGAT 1 cut(s) 294
BsiEI CGRYCG 1 cut(s) 298
BsiSI CCGG 1 cut(s) 927
BslFI GGGAC 1 cut(s) 117
BslI CCNNNNNNNGG 3 cut(s) 317, 550, 615
BsmAI GTCTC 1 cut(s) 151
BsmFI GGGAC 1 cut(s) 117
Bsp143I GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
Bsp19I CCATGG 2 cut(s) 62, 475
BspACI CCGC 4 cut(s) 422, 472, 730, 943
BspCNI CTCAG 1 cut(s) 1017
BspDI ATCGAT 1 cut(s) 294
BspFNI CGCG 1 cut(s) 422
BspHI TCATGA 1 cut(s) 286
BspLI GGNNCC 1 cut(s) 385
BspMI ACCTGC 1 cut(s) 781
BspPI GGATC 2 cut(s) 248, 450
BspT107I GGYRCC 1 cut(s) 383
BsrDI GCAATG 1 cut(s) 955
BsrI ACTGG 2 cut(s) 728, 964
BssECI CCNNGG 5 cut(s) 62, 194, 311, 475, 743
BssMI GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
BssNI GRCGYC 1 cut(s) 106
BssT1I CCWWGG 4 cut(s) 62, 194, 475, 743
Bst2UI CCWGG 1 cut(s) 312
Bst4CI ACNGT 2 cut(s) 353, 501
BstACI GRCGYC 1 cut(s) 106
BstC8I GCNNGC 3 cut(s) 224, 623, 988
BstDEI CTNAG 1 cut(s) 1004
BstDSI CCRYGG 2 cut(s) 62, 475
BstF5I GGATG 1 cut(s) 398
BstFNI CGCG 1 cut(s) 422
BstKTI GATC 8 cut(s) 73, 256, 298, 394, 445, 511, 877, 997
BstMAI GTCTC 1 cut(s) 151
BstMBI GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
BstMCI CGRYCG 1 cut(s) 298
BstMWI GCNNNNNNNGC 3 cut(s) 471, 680, 969
BstNI CCWGG 1 cut(s) 312
BstSCI CCNGG 1 cut(s) 310
BstSFI CTRYAG 1 cut(s) 180
BstUI CGCG 1 cut(s) 422
BstV1I GCAGC 4 cut(s) 251, 683, 957, 1002
BstV2I GAAGAC 1 cut(s) 562
BstXI CCANNNNNNTGG 1 cut(s) 63
Bsu15I ATCGAT 1 cut(s) 294
BsuTUI ATCGAT 1 cut(s) 294
BtgI CCRYGG 2 cut(s) 62, 475
BtsCI GGATG 1 cut(s) 398
BveI ACCTGC 1 cut(s) 781
Cac8I GCNNGC 3 cut(s) 224, 623, 988
CciI TCATGA 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 121
ClaI ATCGAT 1 cut(s) 294
CseI GACGC 1 cut(s) 114
Csp6I GTAC 2 cut(s) 384, 721
CviQI GTAC 2 cut(s) 384, 721
DdeI CTNAG 1 cut(s) 1004
DpnI GATC 8 cut(s) 72, 255, 297, 393, 444, 510, 876, 996
DpnII GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
Eco130I CCWWGG 4 cut(s) 62, 194, 475, 743
Eco47I GGWCC 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 582
EcoRII CCWGG 1 cut(s) 310
EcoT14I CCWWGG 4 cut(s) 62, 194, 475, 743
EcoT22I ATGCAT 2 cut(s) 955, 974
ErhI CCWWGG 4 cut(s) 62, 194, 475, 743
FalI AAGNNNNNCTT 2 cut(s) 542, 574
FaqI GGGAC 1 cut(s) 117
FauI CCCGC 1 cut(s) 723
FauNDI CATATG 2 cut(s) 274, 999
Fnu4HI GCNGC 6 cut(s) 265, 472, 672, 946, 991, 1044
FokI GGATG 1 cut(s) 385
Fsp4HI GCNGC 6 cut(s) 265, 472, 672, 946, 991, 1044
FspBI CTAG 8 cut(s) 161, 261, 360, 587, 668, 684, 716, 761
GluI GCNGC 6 cut(s) 265, 472, 672, 946, 991, 1044
HapII CCGG 1 cut(s) 927
HgaI GACGC 1 cut(s) 114
Hin1I GRCGYC 1 cut(s) 106
HinfI GANTC 1 cut(s) 127
HpaII CCGG 1 cut(s) 927
HphI GGTGA 5 cut(s) 449, 491, 796, 836, 866
Hpy166II GTNNAC 4 cut(s) 121, 492, 504, 721
Hpy188I TCNGA 5 cut(s) 70, 204, 391, 637, 1007
Hpy188III TCNNGA 3 cut(s) 287, 446, 898
Hpy8I GTNNAC 4 cut(s) 121, 492, 504, 721
Hpy99I CGWCG 1 cut(s) 516
HpyCH4III ACNGT 2 cut(s) 353, 501
HpyCH4IV ACGT 1 cut(s) 514
HpyCH4V TGCA 9 cut(s) 96, 147, 222, 267, 341, 427, 772, 953, 972
HpyF10VI GCNNNNNNNGC 3 cut(s) 471, 680, 969
HpyF3I CTNAG 1 cut(s) 1004
HpySE526I ACGT 1 cut(s) 514
Hsp92I GRCGYC 1 cut(s) 106
KpnI GGTACC 1 cut(s) 387
Kzo9I GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
LmnI GCTCC 2 cut(s) 618, 945
Lsp1109I GCAGC 4 cut(s) 251, 683, 957, 1002
LweI GCATC 1 cut(s) 105
MaeI CTAG 8 cut(s) 161, 261, 360, 587, 668, 684, 716, 761
MaeII ACGT 1 cut(s) 514
MaeIII GTNAC 2 cut(s) 657, 824
MalI GATC 8 cut(s) 72, 255, 297, 393, 444, 510, 876, 996
MboI GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
MboII GAAGA 3 cut(s) 550, 553, 562
MfeI CAATTG 1 cut(s) 217
MluCI AATT 6 cut(s) 151, 211, 217, 531, 582, 612
MnlI CCTC 8 cut(s) 257, 397, 433, 442, 450, 700, 976, 1033
Mph1103I ATGCAT 2 cut(s) 955, 974
MseI TTAA 2 cut(s) 75, 366
MslI CAYNNNNRTG 2 cut(s) 61, 135
MspI CCGG 1 cut(s) 927
MspR9I CCNGG 1 cut(s) 312
MunI CAATTG 1 cut(s) 217
MvaI CCWGG 1 cut(s) 312
MvnI CGCG 1 cut(s) 422
MwoI GCNNNNNNNGC 3 cut(s) 471, 680, 969
NcoI CCATGG 2 cut(s) 62, 475
NdeI CATATG 2 cut(s) 274, 999
NdeII GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
NlaIV GGNNCC 1 cut(s) 385
NmuCI GTSAC 1 cut(s) 824
NsiI ATGCAT 2 cut(s) 955, 974
PagI TCATGA 1 cut(s) 286
PfeI GAWTC 1 cut(s) 127
PflMI CCANNNNNTGG 1 cut(s) 615
PkrI GCNGC 6 cut(s) 266, 473, 673, 947, 992, 1045
Ple19I CGATCG 1 cut(s) 298
Psp6I CCWGG 1 cut(s) 310
PspGI CCWGG 1 cut(s) 310
PspN4I GGNNCC 1 cut(s) 385
PspPI GGNCC 1 cut(s) 121
PvuI CGATCG 1 cut(s) 298
RsaI GTAC 2 cut(s) 385, 722
RsaNI GTAC 2 cut(s) 384, 721
RseI CAYNNNNRTG 2 cut(s) 61, 135
SaqAI TTAA 2 cut(s) 75, 366
SatI GCNGC 6 cut(s) 265, 472, 672, 946, 991, 1044
Sau3AI GATC 8 cut(s) 70, 253, 295, 391, 442, 508, 874, 994
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 1 cut(s) 312
SfaNI GCATC 1 cut(s) 105
SfcI CTRYAG 1 cut(s) 180
SinI GGWCC 1 cut(s) 121
SmiMI CAYNNNNRTG 2 cut(s) 61, 135
SmlI CTYRAG 1 cut(s) 29
SmoI CTYRAG 1 cut(s) 29
SpeI ACTAGT 1 cut(s) 160
Sse9I AATT 6 cut(s) 151, 211, 217, 531, 582, 612
SsiI CCGC 4 cut(s) 422, 472, 730, 943
SspMI CTAG 8 cut(s) 161, 261, 360, 587, 668, 684, 716, 761
StyD4I CCNGG 1 cut(s) 310
StyI CCWWGG 4 cut(s) 62, 194, 475, 743
TaaI ACNGT 2 cut(s) 353, 501
TaiI ACGT 1 cut(s) 517
TaqI TCGA 2 cut(s) 294, 511
TaqII GACCGA 1 cut(s) 288
TasI AATT 6 cut(s) 151, 211, 217, 531, 582, 612
TatI WGTACW 1 cut(s) 720
TauI GCSGC 1 cut(s) 474
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 2 cut(s) 75, 366
Tru9I TTAA 2 cut(s) 75, 366
TseFI GTSAC 1 cut(s) 824
TseI GCWGC 5 cut(s) 264, 671, 945, 990, 1043
Tsp45I GTSAC 1 cut(s) 824
TspDTI ATGAA 4 cut(s) 119, 303, 582, 791
Van91I CCANNNNNTGG 1 cut(s) 615
VpaK11BI GGWCC 1 cut(s) 121
XapI RAATTY 3 cut(s) 211, 582, 612
XspI CTAG 8 cut(s) 161, 261, 360, 587, 668, 684, 716, 761
Zsp2I ATGCAT 2 cut(s) 955, 974
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.