Rroxscaffold_1G00004360

Suppressor of mec-8 and unc-52 protein homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
6065495 .. 6073017
7523 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00004360.1

Sequence Viewer

Length: 297 bp
ATGACTTTGCATAGGAGTAAAGTCGACTGTCCACAGCTTGAGGAAATGGCCACTGTCAGTTTTGATGGTGCTGTACTTGGACAAATTCCTGCAAGTATGTCATATCTTTGTGTTGGATCTTCTGGCAAGGCTGACAAGAAGAAAAAGAAGGGGAAAGATGCAAAAGTTGTTGCATATCTTTCAGACAAAGAAATCTTTTATGTCGAAGATAAAGTAGGAGGAGTTCAATTATGGGATAGTTTCAGTCACCCTAGCAATACAATCTTACTTGAACAAATGCTAGGATTCGATAGTTAA

Protein Analysis

98

Amino Acids

10.73

Weight (kDa)

6.06

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RED_N PF07808 2 - 49 8e-09 RED-like protein N-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020672)

Species Orthologous Gene IDs
rosa_laevigata RLG00000021754 RLG00000036711
rosa_multiflora Rmu_sc0004168.1_g000002
rosa_roxburghii Rroxscaffold_1G00004360
rosa_rugosa Rorug05G0456400
rosa_samantha Rh5CG556500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 24
AclWI GGATC 1 cut(s) 124
AcoI YGGCCR 1 cut(s) 48
AcsI RAATTY 1 cut(s) 84
AfaI GTAC 1 cut(s) 75
AgsI TTSAA 2 cut(s) 227, 272
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
AlwI GGATC 1 cut(s) 124
AoxI GGCC 1 cut(s) 48
ApoI RAATTY 1 cut(s) 84
AsuHPI GGTGA 1 cut(s) 239
BalI TGGCCA 1 cut(s) 50
BccI CCATC 1 cut(s) 59
BfaI CTAG 2 cut(s) 252, 281
BmsI GCATC 1 cut(s) 148
BpuEI CTTGAG 1 cut(s) 59
BseRI GAGGAG 1 cut(s) 234
BshFI GGCC 1 cut(s) 50
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 116
BspANI GGCC 1 cut(s) 50
BspPI GGATC 1 cut(s) 124
BssMI GATC 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 29, 55
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
BsuRI GGCC 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 51
Csp6I GTAC 1 cut(s) 74
CviJI RGCY 3 cut(s) 37, 50, 131
CviKI_1 RGCY 3 cut(s) 37, 50, 131
CviQI GTAC 1 cut(s) 74
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
EaeI YGGCCR 1 cut(s) 48
FaiI YATR 6 cut(s) 12, 98, 103, 175, 201, 232
FblI GTMKAC 1 cut(s) 24
FspBI CTAG 2 cut(s) 252, 281
HaeIII GGCC 1 cut(s) 50
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 1 cut(s) 285
HphI GGTGA 1 cut(s) 239
Hpy166II GTNNAC 2 cut(s) 25, 32
Hpy188I TCNGA 1 cut(s) 184
Hpy8I GTNNAC 2 cut(s) 25, 32
HpyAV CCTTC 1 cut(s) 142
HpyCH4III ACNGT 2 cut(s) 29, 55
HpyCH4V TGCA 4 cut(s) 10, 92, 161, 173
Kzo9I GATC 1 cut(s) 116
LpnPI CCDG 2 cut(s) 102, 108
LweI GCATC 1 cut(s) 148
MaeI CTAG 2 cut(s) 252, 281
MaeIII GTNAC 1 cut(s) 245
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 3 cut(s) 111, 151, 218
MflI RGATCY 1 cut(s) 116
MlsI TGGCCA 1 cut(s) 50
MluCI AATT 2 cut(s) 84, 227
MluNI TGGCCA 1 cut(s) 50
MmeI TCCRAC 1 cut(s) 94
MnlI CCTC 2 cut(s) 34, 212
Mox20I TGGCCA 1 cut(s) 50
MscI TGGCCA 1 cut(s) 50
MseI TTAA 1 cut(s) 295
Msp20I TGGCCA 1 cut(s) 50
NdeII GATC 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 245
PfeI GAWTC 1 cut(s) 285
PsrI GAACNNNNNNTAC 2 cut(s) 207, 239
PsuI RGATCY 1 cut(s) 116
RsaI GTAC 1 cut(s) 75
RsaNI GTAC 1 cut(s) 74
SalI GTCGAC 1 cut(s) 23
SaqAI TTAA 1 cut(s) 295
Sau3AI GATC 1 cut(s) 116
SetI ASST 1 cut(s) 39
SfaNI GCATC 1 cut(s) 148
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 2 cut(s) 84, 227
SspMI CTAG 2 cut(s) 252, 281
TaaI ACNGT 2 cut(s) 29, 55
TaqI TCGA 3 cut(s) 24, 204, 288
TasI AATT 2 cut(s) 84, 227
TatI WGTACW 1 cut(s) 73
TfiI GAWTC 1 cut(s) 285
Tru1I TTAA 1 cut(s) 295
Tru9I TTAA 1 cut(s) 295
TscAI CASTG 1 cut(s) 58
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspRI CASTG 1 cut(s) 58
XapI RAATTY 1 cut(s) 84
XmiI GTMKAC 1 cut(s) 24
XspI CTAG 2 cut(s) 252, 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.