Rroxscaffold_1G00027940

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
35620035 .. 35625055
5021 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00027940.1

Sequence Viewer

Length: 237 bp
ATGGTTGTGAGAAATGTTGTTAGTTCGAATGCAATTATTACTGGGTATATTGATGTTGGAGAGTACCTAATGGCATTGAAGCTTTTTGTGCAGTTGCTTGTGGACGAGGTCGAGTTTGACTCTGTTTCGAAGTTGGTTGTGATTCAAGCTAGTGCAAAAATTGGATCTATTGAATTGACAATCGAAAATGCGGGCTTAAAGGGCCAGGTCGGGCTTGTCCCTAATGAACTCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.39

Weight (kDa)

4.65

Isoelectric Point (pI)

17.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015655)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AclWI GGATC 1 cut(s) 172
AfaI GTAC 1 cut(s) 65
AgsI TTSAA 3 cut(s) 79, 146, 173
AjnI CCWGG 1 cut(s) 204
AluBI AGCT 2 cut(s) 82, 149
AluI AGCT 2 cut(s) 82, 149
AlwI GGATC 1 cut(s) 172
AoxI GGCC 1 cut(s) 202
AspS9I GGNCC 1 cut(s) 202
AsuII TTCGAA 2 cut(s) 26, 128
BciT130I CCWGG 1 cut(s) 206
BfaI CTAG 1 cut(s) 150
Bme1390I CCNGG 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 202
BmrFI CCNGG 1 cut(s) 206
BmrI ACTGGG 1 cut(s) 51
BmuI ACTGGG 1 cut(s) 51
BplI GAGNNNNNCTC 2 cut(s) 104, 136
Bpu14I TTCGAA 2 cut(s) 26, 128
Bse1I ACTGG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 206
BseNI ACTGG 1 cut(s) 46
BsgI GTGCAG 1 cut(s) 110
BshFI GGCC 1 cut(s) 204
BslFI GGGAC 1 cut(s) 203
BsmFI GGGAC 1 cut(s) 203
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 1 cut(s) 204
Bsp119I TTCGAA 2 cut(s) 26, 128
Bsp143I GATC 1 cut(s) 164
BspACI CCGC 1 cut(s) 191
BspANI GGCC 1 cut(s) 204
BspPI GGATC 1 cut(s) 172
BspT104I TTCGAA 2 cut(s) 26, 128
BsrI ACTGG 1 cut(s) 46
BssMI GATC 1 cut(s) 164
Bst2UI CCWGG 1 cut(s) 206
BstBI TTCGAA 2 cut(s) 26, 128
BstC8I GCNNGC 1 cut(s) 193
BstKTI GATC 1 cut(s) 167
BstMBI GATC 1 cut(s) 164
BstMWI GCNNNNNNNGC 2 cut(s) 88, 201
BstNI CCWGG 1 cut(s) 206
BstSCI CCNGG 1 cut(s) 204
BstX2I RGATCY 1 cut(s) 164
BstYI RGATCY 1 cut(s) 164
BsuRI GGCC 1 cut(s) 204
Cac8I GCNNGC 1 cut(s) 193
Cfr13I GGNCC 1 cut(s) 202
Csp6I GTAC 1 cut(s) 64
CviJI RGCY 5 cut(s) 82, 149, 195, 204, 214
CviKI_1 RGCY 5 cut(s) 82, 149, 195, 204, 214
CviQI GTAC 1 cut(s) 64
DpnI GATC 1 cut(s) 166
DpnII GATC 1 cut(s) 164
EcoRII CCWGG 1 cut(s) 204
FaiI YATR 1 cut(s) 48
FaqI GGGAC 1 cut(s) 203
FauI CCCGC 1 cut(s) 184
FspBI CTAG 1 cut(s) 150
HaeIII GGCC 1 cut(s) 204
HindIII AAGCTT 1 cut(s) 80
HinfI GANTC 2 cut(s) 119, 142
Hpy166II GTNNAC 1 cut(s) 103
Hpy8I GTNNAC 1 cut(s) 103
HpyCH4V TGCA 3 cut(s) 32, 91, 155
HpyF10VI GCNNNNNNNGC 2 cut(s) 88, 201
Kzo9I GATC 1 cut(s) 164
LpnPI CCDG 3 cut(s) 27, 191, 218
MaeI CTAG 1 cut(s) 150
MalI GATC 1 cut(s) 166
MboI GATC 1 cut(s) 164
MflI RGATCY 1 cut(s) 164
MluCI AATT 3 cut(s) 33, 159, 173
MlyI GAGTC 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 37
MnlI CCTC 1 cut(s) 100
MseI TTAA 1 cut(s) 197
MspR9I CCNGG 1 cut(s) 206
Mva1269I GAATGC 1 cut(s) 34
MvaI CCWGG 1 cut(s) 206
MwoI GCNNNNNNNGC 2 cut(s) 88, 201
NdeII GATC 1 cut(s) 164
NspV TTCGAA 2 cut(s) 26, 128
PctI GAATGC 1 cut(s) 34
PfeI GAWTC 1 cut(s) 142
PflFI GACNNNGTC 1 cut(s) 107
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 204
PspGI CCWGG 1 cut(s) 204
PspPI GGNCC 1 cut(s) 202
PsuI RGATCY 1 cut(s) 164
PsyI GACNNNGTC 1 cut(s) 107
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SaqAI TTAA 1 cut(s) 197
Sau3AI GATC 1 cut(s) 164
Sau96I GGNCC 1 cut(s) 202
SchI GAGTC 1 cut(s) 113
ScrFI CCNGG 1 cut(s) 206
SetI ASST 5 cut(s) 69, 84, 111, 151, 210
SfuI TTCGAA 2 cut(s) 26, 128
Sse9I AATT 3 cut(s) 33, 159, 173
SsiI CCGC 1 cut(s) 191
SspMI CTAG 1 cut(s) 150
StyD4I CCNGG 1 cut(s) 204
TaqI TCGA 4 cut(s) 26, 111, 128, 183
TasI AATT 3 cut(s) 33, 159, 173
TfiI GAWTC 1 cut(s) 142
Tru1I TTAA 1 cut(s) 197
Tru9I TTAA 1 cut(s) 197
Tth111I GACNNNGTC 1 cut(s) 107
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.