Rroxscaffold_1G00038950

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
56507448 .. 56507774
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00038950.1

Sequence Viewer

Length: 219 bp
ATGGTGAAGGAGCTCACTCTAGAGGAGTGGTTTTCAATAACGCACAGTTTTTCTCAGCAGAGGCTGGTGATTGAAGTGGTTGACTGTGGAAGAAGAAGTGATGTTTCTTGTTTGAGCTCAAGGAATAGTGGGAAGGTGAAGAAAAGGGTCAGCTTTAGATTACCAGAAGAGGCTGATATAATCATTTTCTGTTCACCAAAAGCAGATTATGAAGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.32

Weight (kDa)

5.82

Isoelectric Point (pI)

68.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018401)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g23561
pyrus_communis pycom11g18480
rosa_laevigata RLG00000034079
rosa_roxburghii Rroxscaffold_1G00038950
rosa_rugosa Rorug05G0193600
rosa_samantha Rh5AG279300 Rh5BG283700 Rh5BG284600 Rh5CG316500 Rh5DG293400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 36, 74
AluBI AGCT 3 cut(s) 13, 117, 153
AluI AGCT 3 cut(s) 13, 117, 153
Alw21I GWGCWC 2 cut(s) 15, 119
AlwNI CAGNNNCTG 1 cut(s) 64
AsuHPI GGTGA 4 cut(s) 16, 79, 148, 186
BanII GRGCYC 2 cut(s) 15, 119
Bbv12I GWGCWC 2 cut(s) 15, 119
BfaI CTAG 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 68
BseRI GAGGAG 1 cut(s) 38
BsiHKAI GWGCWC 2 cut(s) 15, 119
Bsp1286I GDGCHC 2 cut(s) 15, 119
BspCNI CTCAG 1 cut(s) 67
Bst4CI ACNGT 2 cut(s) 47, 86
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 54
CaiI CAGNNNCTG 1 cut(s) 64
CviJI RGCY 5 cut(s) 13, 64, 117, 153, 173
CviKI_1 RGCY 5 cut(s) 13, 64, 117, 153, 173
DdeI CTNAG 1 cut(s) 54
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Ecl136II GAGCTC 2 cut(s) 13, 117
Eco24I GRGCYC 2 cut(s) 15, 119
Eco53kI GAGCTC 2 cut(s) 13, 117
EcoICRI GAGCTC 2 cut(s) 13, 117
EcoT38I GRGCYC 2 cut(s) 15, 119
FaiI YATR 2 cut(s) 179, 210
FriOI GRGCYC 2 cut(s) 15, 119
FspBI CTAG 1 cut(s) 20
HincII GTYRAC 1 cut(s) 82
HindII GTYRAC 1 cut(s) 82
HphI GGTGA 4 cut(s) 16, 79, 148, 186
Hpy166II GTNNAC 2 cut(s) 82, 194
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 2 cut(s) 82, 194
HpyAV CCTTC 1 cut(s) 127
HpyCH4III ACNGT 2 cut(s) 47, 86
HpyF3I CTNAG 1 cut(s) 54
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 2 cut(s) 50, 177
MaeI CTAG 1 cut(s) 20
MboII GAAGA 4 cut(s) 102, 105, 151, 179
MhlI GDGCHC 2 cut(s) 15, 119
MnlI CCTC 3 cut(s) 16, 54, 163
Psp124BI GAGCTC 2 cut(s) 15, 119
PstNI CAGNNNCTG 1 cut(s) 64
SacI GAGCTC 2 cut(s) 15, 119
SduI GDGCHC 2 cut(s) 15, 119
SetI ASST 4 cut(s) 15, 119, 138, 155
SgeI CNNG 5 cut(s) 32, 77, 120, 132, 176
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
SspMI CTAG 1 cut(s) 20
SstI GAGCTC 2 cut(s) 15, 119
TaaI ACNGT 2 cut(s) 47, 86
XbaI TCTAGA 1 cut(s) 19
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.