Rroxscaffold_1G00042670
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
61011475 .. 61011768
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00042670.1

Sequence Viewer

Length: 207 bp
ATGGCAGACCCATTGCTACAAGGGAAATACCCCATAAAAGGACTTTACCAAGCACTTGCAGTTGCAGCTATGTGTCTCCAAGAGGAAGCTGCAACTCGGCCTCTGATCAGCGATGTTGTAACAGCTTTAGAATTTTTATCAGTAGATAACCTTGGTGAAGGGGGTAATGAAAATATGGAGAATGACGGTGCAGATGAAGCTAGCTAG

Protein Analysis

68

Amino Acids

7.17

Weight (kDa)

4.05

Isoelectric Point (pI)

24.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020445)

Species Orthologous Gene IDs
pyrus_communis pycom12g20860
rosa_multiflora Rmu_co8356951.1_g000001
rosa_roxburghii Rroxscaffold_1G00042670
rosa_samantha Rh3AG141900 Rh3CG163400 Rh5BG263200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 38
AluBI AGCT 5 cut(s) 68, 89, 125, 200, 204
AluI AGCT 5 cut(s) 68, 89, 125, 200, 204
Alw26I GTCTC 1 cut(s) 80
AoxI GGCC 1 cut(s) 98
ApeKI GCWGC 2 cut(s) 65, 89
ApoI RAATTY 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 167
AsuNHI GCTAGC 1 cut(s) 200
BbvI GCAGC 2 cut(s) 76, 77
BclI TGATCA 1 cut(s) 105
BcoDI GTCTC 1 cut(s) 80
BfaI CTAG 2 cut(s) 201, 205
BisI GCNGC 2 cut(s) 66, 90
BlsI GCNGC 2 cut(s) 67, 91
BmtI GCTAGC 1 cut(s) 204
BsaJI CCNNGG 1 cut(s) 151
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse3DI GCAATG 1 cut(s) 11
BseDI CCNNGG 1 cut(s) 151
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMI GCAATG 1 cut(s) 11
BseXI GCAGC 2 cut(s) 76, 77
BshFI GGCC 1 cut(s) 100
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 80
BsnI GGCC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 105
BspANI GGCC 1 cut(s) 100
BspOI GCTAGC 1 cut(s) 204
BsrDI GCAATG 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 151
Bst4CI ACNGT 1 cut(s) 188
BstC8I GCNNGC 1 cut(s) 202
BstKTI GATC 1 cut(s) 108
BstMAI GTCTC 1 cut(s) 80
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 2 cut(s) 65, 197
BstV1I GCAGC 2 cut(s) 76, 77
BsuRI GGCC 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 126
Cac8I GCNNGC 1 cut(s) 202
CviJI RGCY 6 cut(s) 68, 89, 100, 125, 200, 204
CviKI_1 RGCY 6 cut(s) 68, 89, 100, 125, 200, 204
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
Eco130I CCWWGG 1 cut(s) 151
EcoT14I CCWWGG 1 cut(s) 151
ErhI CCWWGG 1 cut(s) 151
FaiI YATR 3 cut(s) 35, 71, 176
FbaI TGATCA 1 cut(s) 105
Fnu4HI GCNGC 2 cut(s) 66, 90
Fsp4HI GCNGC 2 cut(s) 66, 90
FspBI CTAG 2 cut(s) 201, 205
GluI GCNGC 2 cut(s) 66, 90
HaeIII GGCC 1 cut(s) 100
HphI GGTGA 1 cut(s) 167
Hpy188I TCNGA 1 cut(s) 105
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 188
HpyCH4V TGCA 4 cut(s) 59, 65, 92, 191
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 197
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 1 cut(s) 105
Lsp1109I GCAGC 2 cut(s) 76, 77
MaeI CTAG 2 cut(s) 201, 205
MaeIII GTNAC 1 cut(s) 118
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MluCI AATT 1 cut(s) 131
MnlI CCTC 2 cut(s) 76, 111
MwoI GCNNNNNNNGC 2 cut(s) 65, 197
NdeII GATC 1 cut(s) 105
NheI GCTAGC 1 cut(s) 200
NmeAIII GCCGAG 1 cut(s) 76
PkrI GCNGC 2 cut(s) 67, 91
SatI GCNGC 2 cut(s) 66, 90
Sau3AI GATC 1 cut(s) 105
SetI ASST 6 cut(s) 70, 91, 127, 153, 202, 206
SgeI CNNG 6 cut(s) 32, 62, 68, 92, 108, 164
Sse9I AATT 1 cut(s) 131
SspMI CTAG 2 cut(s) 201, 205
StyI CCWWGG 1 cut(s) 151
TaaI ACNGT 1 cut(s) 188
TasI AATT 1 cut(s) 131
TseI GCWGC 2 cut(s) 65, 89
TspDTI ATGAA 1 cut(s) 183
XapI RAATTY 1 cut(s) 131
XspI CTAG 2 cut(s) 201, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.