Rroxscaffold_2G00117180

protein import into mitochondrial matrix

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0012425
Physical Location & Seq
Reverse (-)
44694276 .. 44698865
4590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00117180.1

Sequence Viewer

Length: 261 bp
ATGGTCGAAACCCTAGCCAATCGGCGCCATTCCCTTTGCAAATTCTTCCGCAGGGCGATCGCCTACTTATCCACCTTTGACCGCGTCGACCACCAAGGGTTCCAAGTGGCGGTGTTGAACCTCCTTGGGGAACTTTTCAACGAAGTTGTGGGAGATGAAGAAACAATATTATGTGGTGATCCGGGTGAGTACATGTGTGGTGATTTGTGTGAGTGCCTATGTGATGGCATGAGTGATGATCCGTGTGAGTGCCTCGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.64

Weight (kDa)

4.26

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 24
AccI GTMKAC 1 cut(s) 87
AccII CGCG 1 cut(s) 84
AciI CCGC 3 cut(s) 49, 82, 110
AclWI GGATC 2 cut(s) 173, 233
AcsI RAATTY 1 cut(s) 41
AcyI GRCGYC 1 cut(s) 25
AfaI GTAC 1 cut(s) 191
AfiI CCNNNNNNNGG 2 cut(s) 109, 127
AflIII ACRYGT 1 cut(s) 192
AgsI TTSAA 2 cut(s) 118, 139
AlwI GGATC 2 cut(s) 173, 233
ApoI RAATTY 1 cut(s) 41
AsiSI GCGATCGC 1 cut(s) 60
AspLEI GCGC 1 cut(s) 27
AsuC2I CCSGG 1 cut(s) 183
AsuHPI GGTGA 3 cut(s) 188, 197, 212
BanI GGYRCC 1 cut(s) 24
BauI CACGAG 1 cut(s) 254
BccI CCATC 1 cut(s) 218
BcgI CGANNNNNNTGC 2 cut(s) 40, 74
BcnI CCSGG 1 cut(s) 183
BfaI CTAG 1 cut(s) 14
BfoI RGCGCY 1 cut(s) 28
Bme1390I CCNGG 1 cut(s) 183
BmiI GGNNCC 2 cut(s) 26, 101
BmrFI CCNGG 1 cut(s) 183
BpuMI CCSGG 1 cut(s) 183
BsaHI GRCGYC 1 cut(s) 25
BsaJI CCNNGG 2 cut(s) 94, 124
Bsc4I CCNNNNNNNGG 2 cut(s) 109, 127
BseDI CCNNGG 2 cut(s) 94, 124
BseLI CCNNNNNNNGG 2 cut(s) 109, 127
Bsh1236I CGCG 1 cut(s) 84
Bsh1285I CGRYCG 1 cut(s) 60
BshNI GGYRCC 1 cut(s) 24
BsiEI CGRYCG 1 cut(s) 60
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 109, 127
Bsp143I GATC 3 cut(s) 57, 178, 238
BspACI CCGC 3 cut(s) 49, 82, 110
BspFNI CGCG 1 cut(s) 84
BspLI GGNNCC 2 cut(s) 26, 101
BspPI GGATC 2 cut(s) 173, 233
BspT107I GGYRCC 1 cut(s) 24
BssECI CCNNGG 2 cut(s) 94, 124
BssMI GATC 3 cut(s) 57, 178, 238
BssNI GRCGYC 1 cut(s) 25
BssSI CACGAG 1 cut(s) 254
BssT1I CCWWGG 2 cut(s) 94, 124
Bst2BI CACGAG 1 cut(s) 254
BstACI GRCGYC 1 cut(s) 25
BstFNI CGCG 1 cut(s) 84
BstH2I RGCGCY 1 cut(s) 28
BstHHI GCGC 1 cut(s) 27
BstKTI GATC 3 cut(s) 60, 181, 241
BstMBI GATC 3 cut(s) 57, 178, 238
BstMCI CGRYCG 1 cut(s) 60
BstNSI RCATGY 1 cut(s) 196
BstSCI CCNGG 1 cut(s) 181
BstUI CGCG 1 cut(s) 84
CfoI GCGC 1 cut(s) 27
CseI GACGC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 190
CviAII CATG 2 cut(s) 193, 229
CviJI RGCY 1 cut(s) 17
CviKI_1 RGCY 1 cut(s) 17
CviQI GTAC 1 cut(s) 190
DinI GGCGCC 1 cut(s) 26
DpnI GATC 3 cut(s) 59, 180, 240
DpnII GATC 3 cut(s) 57, 178, 238
Eco130I CCWWGG 2 cut(s) 94, 124
EcoT14I CCWWGG 2 cut(s) 94, 124
EgeI GGCGCC 1 cut(s) 26
EheI GGCGCC 1 cut(s) 26
ErhI CCWWGG 2 cut(s) 94, 124
FaeI CATG 2 cut(s) 196, 232
FaiI YATR 4 cut(s) 172, 194, 220, 230
FatI CATG 2 cut(s) 192, 228
FblI GTMKAC 1 cut(s) 87
FspBI CTAG 1 cut(s) 14
GlaI GCGC 1 cut(s) 26
HaeII RGCGCY 1 cut(s) 28
HapII CCGG 1 cut(s) 182
HgaI GACGC 1 cut(s) 73
HhaI GCGC 1 cut(s) 27
Hin1I GRCGYC 1 cut(s) 25
Hin1II CATG 2 cut(s) 196, 232
Hin6I GCGC 1 cut(s) 25
HinP1I GCGC 1 cut(s) 25
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HpaII CCGG 1 cut(s) 182
HphI GGTGA 3 cut(s) 188, 197, 212
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 39
Hsp92I GRCGYC 1 cut(s) 25
Hsp92II CATG 2 cut(s) 196, 232
HspAI GCGC 1 cut(s) 25
KasI GGCGCC 1 cut(s) 24
Kzo9I GATC 3 cut(s) 57, 178, 238
LpnPI CCDG 2 cut(s) 37, 195
MaeI CTAG 1 cut(s) 14
MalI GATC 3 cut(s) 59, 180, 240
MboI GATC 3 cut(s) 57, 178, 238
MboII GAAGA 2 cut(s) 37, 170
MluCI AATT 1 cut(s) 41
Mly113I GGCGCC 1 cut(s) 25
MnlI CCTC 1 cut(s) 131
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 1 cut(s) 183
MvnI CGCG 1 cut(s) 84
NarI GGCGCC 1 cut(s) 25
NciI CCSGG 1 cut(s) 183
NdeII GATC 3 cut(s) 57, 178, 238
NlaIII CATG 2 cut(s) 196, 232
NlaIV GGNNCC 2 cut(s) 26, 101
NspI RCATGY 1 cut(s) 196
PciI ACATGT 1 cut(s) 192
PflFI GACNNNGTC 1 cut(s) 83
Ple19I CGATCG 1 cut(s) 60
PluTI GGCGCC 1 cut(s) 28
PscI ACATGT 1 cut(s) 192
PspN4I GGNNCC 2 cut(s) 26, 101
PsyI GACNNNGTC 1 cut(s) 83
PvuI CGATCG 1 cut(s) 60
RgaI GCGATCGC 1 cut(s) 60
RsaI GTAC 1 cut(s) 191
RsaNI GTAC 1 cut(s) 190
SalI GTCGAC 1 cut(s) 86
Sau3AI GATC 3 cut(s) 57, 178, 238
ScrFI CCNGG 1 cut(s) 183
SetI ASST 2 cut(s) 77, 123
SfaAI GCGATCGC 1 cut(s) 60
SfoI GGCGCC 1 cut(s) 26
SgfI GCGATCGC 1 cut(s) 60
Sse9I AATT 1 cut(s) 41
SsiI CCGC 3 cut(s) 49, 82, 110
SspDI GGCGCC 1 cut(s) 24
SspI AATATT 1 cut(s) 168
SspMI CTAG 1 cut(s) 14
StyD4I CCNGG 1 cut(s) 181
StyI CCWWGG 2 cut(s) 94, 124
TaqI TCGA 2 cut(s) 6, 87
TasI AATT 1 cut(s) 41
TatI WGTACW 1 cut(s) 189
TspDTI ATGAA 1 cut(s) 171
TspGWI ACGGA 1 cut(s) 231
Tth111I GACNNNGTC 1 cut(s) 83
XapI RAATTY 1 cut(s) 41
XceI RCATGY 1 cut(s) 196
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.