Rroxscaffold_3G00249800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0019299
Physical Location & Seq
Reverse (-)
43573869 .. 43579261
5393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00249800.1

Sequence Viewer

Length: 207 bp
ATGGATAACAGAGCACTTTACAAAGACGTTTCCGAGGAGCTGGCAACTACTAGGGAGTTGCTCATTGCGATTTCTCACCCTACTGCAGATCAGGTCCGCGATTTGAGTTTCGTGCCTGTGGACGTGGTTGCAGTGTCAAATGGCGATGTATCGGAGCAGTACCGATCTAAACTGATATCTATTTCTTGTGAGTCCCCAAATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.51

Weight (kDa)

4.5

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF6865 PF21737 5 - 67 7.3e-15 Family of unknown function (DUF6865)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019299)

Species Orthologous Gene IDs
prunus_persica Prupe.5G041600_v2.0.a1
rosa_chinensis RchiOBHm_Chr7g0209051
rosa_roxburghii Rroxscaffold_3G00249800
rosa_rugosa Rorug07G0108400 Rorug07G0108500
rosa_samantha Rh7AG243000 Rh7BG238000 Rh7CG258200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AciI CCGC 1 cut(s) 97
AfaI GTAC 1 cut(s) 161
AjiI CACGTC 1 cut(s) 124
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
Alw21I GWGCWC 1 cut(s) 16
AspS9I GGNCC 1 cut(s) 94
AsuHPI GGTGA 1 cut(s) 68
AvaII GGWCC 1 cut(s) 94
Bbv12I GWGCWC 1 cut(s) 16
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 94
BmgBI CACGTC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 33
Bse3DI GCAATG 1 cut(s) 63
BseDI CCNNGG 1 cut(s) 33
BseMI GCAATG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 50
Bsh1236I CGCG 1 cut(s) 99
BsiHKAI GWGCWC 1 cut(s) 16
BslFI GGGAC 1 cut(s) 178
BsmFI GGGAC 1 cut(s) 178
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 2 cut(s) 88, 164
BspACI CCGC 1 cut(s) 97
BspFNI CGCG 1 cut(s) 99
BspMAI CTGCAG 1 cut(s) 88
BsrDI GCAATG 1 cut(s) 63
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 2 cut(s) 88, 164
BstC8I GCNNGC 1 cut(s) 42
BstFNI CGCG 1 cut(s) 99
BstKTI GATC 2 cut(s) 91, 167
BstMBI GATC 2 cut(s) 88, 164
BstSFI CTRYAG 1 cut(s) 84
BstUI CGCG 1 cut(s) 99
BtgZI GCGATG 1 cut(s) 159
BtrI CACGTC 1 cut(s) 124
BtsI GCAGTG 1 cut(s) 138
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 94
Csp6I GTAC 1 cut(s) 160
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
CviQI GTAC 1 cut(s) 160
DpnI GATC 2 cut(s) 90, 166
DpnII GATC 2 cut(s) 88, 164
Eco32I GATATC 1 cut(s) 177
Eco47I GGWCC 1 cut(s) 94
EcoRV GATATC 1 cut(s) 177
FaiI YATR 2 cut(s) 203, 205
FaqI GGGAC 1 cut(s) 178
FspBI CTAG 1 cut(s) 51
HinfI GANTC 1 cut(s) 191
HphI GGTGA 1 cut(s) 68
Hpy166II GTNNAC 1 cut(s) 121
Hpy188I TCNGA 2 cut(s) 34, 154
Hpy8I GTNNAC 1 cut(s) 121
HpyCH4IV ACGT 2 cut(s) 27, 123
HpyCH4V TGCA 2 cut(s) 86, 131
HpySE526I ACGT 2 cut(s) 27, 123
Kzo9I GATC 2 cut(s) 88, 164
LmnI GCTCC 2 cut(s) 37, 154
LpnPI CCDG 3 cut(s) 26, 77, 129
MaeI CTAG 1 cut(s) 51
MaeII ACGT 2 cut(s) 27, 123
MalI GATC 2 cut(s) 90, 166
MboI GATC 2 cut(s) 88, 164
MhlI GDGCHC 1 cut(s) 16
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 1 cut(s) 28
MvnI CGCG 1 cut(s) 99
NdeII GATC 2 cut(s) 88, 164
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
PspPI GGNCC 1 cut(s) 94
PstI CTGCAG 1 cut(s) 88
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
Sau3AI GATC 2 cut(s) 88, 164
Sau96I GGNCC 1 cut(s) 94
SchI GAGTC 1 cut(s) 200
SduI GDGCHC 1 cut(s) 16
SetI ASST 4 cut(s) 30, 42, 96, 126
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 9 cut(s) 46, 53, 63, 104, 110, 124, 128, 136, 198
SinI GGWCC 1 cut(s) 94
SsiI CCGC 1 cut(s) 97
SspMI CTAG 1 cut(s) 51
TaiI ACGT 2 cut(s) 30, 126
TscAI CASTG 1 cut(s) 138
TspRI CASTG 1 cut(s) 138
VpaK11BI GGWCC 1 cut(s) 94
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.