Rroxscaffold_3G00250700

Provides the precursors necessary for DNA synthesis. Catalyzes the biosynthesis of deoxyribonucleotides from the corresponding ribonucleotides

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
44480917 .. 44485707
4791 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00250700.1

Sequence Viewer

Length: 201 bp
ATGAATTCCGAGAGTTCTAGAATTGATGTGAATTTGGTGCAGTTGGCGGCAAGGATTGTTGTTTCAAACCTACACAAGAACACTAAGAAGTCCTTTTCGAGACAAATAATCAAGAGAAGTAGTACATGGTGGAGAGATGGGTTCAGCCCTTGGCAACAGAGGGATCAAATGAATATAATTCAAGGTAAGAAGGCAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.

Protein Analysis

66

Amino Acids

7.74

Weight (kDa)

11.42

Isoelectric Point (pI)

53.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018761)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 47
AclWI GGATC 1 cut(s) 171
AcsI RAATTY 2 cut(s) 4, 31
AfaI GTAC 1 cut(s) 124
AgsI TTSAA 2 cut(s) 66, 182
Alw26I GTCTC 1 cut(s) 94
AlwI GGATC 1 cut(s) 171
ApoI RAATTY 2 cut(s) 4, 31
BccI CCATC 1 cut(s) 131
BcoDI GTCTC 1 cut(s) 94
BfaI CTAG 1 cut(s) 18
BisI GCNGC 1 cut(s) 48
BlsI GCNGC 1 cut(s) 49
BsaJI CCNNGG 1 cut(s) 149
BseDI CCNNGG 1 cut(s) 149
BsgI GTGCAG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 163
BspACI CCGC 1 cut(s) 47
BspPI GGATC 1 cut(s) 171
BssECI CCNNGG 1 cut(s) 149
BssMI GATC 1 cut(s) 163
BssT1I CCWWGG 1 cut(s) 149
BstDEI CTNAG 1 cut(s) 84
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 94
BstMBI GATC 1 cut(s) 163
Csp6I GTAC 1 cut(s) 123
CviAII CATG 1 cut(s) 126
CviJI RGCY 1 cut(s) 147
CviKI_1 RGCY 1 cut(s) 147
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 1 cut(s) 84
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco130I CCWWGG 1 cut(s) 149
EcoRI GAATTC 1 cut(s) 4
EcoT14I CCWWGG 1 cut(s) 149
ErhI CCWWGG 1 cut(s) 149
FaeI CATG 1 cut(s) 129
FaiI YATR 2 cut(s) 127, 176
FalI AAGNNNNNCTT 2 cut(s) 77, 109
FatI CATG 1 cut(s) 125
Fnu4HI GCNGC 1 cut(s) 48
Fsp4HI GCNGC 1 cut(s) 48
FspBI CTAG 1 cut(s) 18
GluI GCNGC 1 cut(s) 48
Hin1II CATG 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 10
Hpy188III TCNNGA 3 cut(s) 18, 99, 112
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 84
Hsp92II CATG 1 cut(s) 129
Kzo9I GATC 1 cut(s) 163
MaeI CTAG 1 cut(s) 18
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MluCI AATT 4 cut(s) 4, 21, 31, 177
MnlI CCTC 1 cut(s) 153
NdeII GATC 1 cut(s) 163
NlaIII CATG 1 cut(s) 129
PkrI GCNGC 1 cut(s) 49
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SatI GCNGC 1 cut(s) 48
Sau3AI GATC 1 cut(s) 163
SetI ASST 2 cut(s) 72, 187
SgeI CNNG 9 cut(s) 22, 30, 63, 88, 111, 124, 138, 162, 194
Sse9I AATT 4 cut(s) 4, 21, 31, 177
SsiI CCGC 1 cut(s) 47
SspMI CTAG 1 cut(s) 18
StyI CCWWGG 1 cut(s) 149
TaqI TCGA 1 cut(s) 98
TasI AATT 4 cut(s) 4, 21, 31, 177
TatI WGTACW 1 cut(s) 122
TauI GCSGC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 17, 185
XapI RAATTY 2 cut(s) 4, 31
XbaI TCTAGA 1 cut(s) 17
XspI CTAG 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.