Rroxscaffold_4G00322200

Ataxin-3 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0019996
Physical Location & Seq
Reverse (-)
52348332 .. 52348571
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00322200.1

Sequence Viewer

Length: 240 bp
ATGATGTACCACGGGGTGCGGGAGTCGAAGCCGTGCGTTGTGCATCTCGTCAACATGGCGTTGCAGGGTCCTTTCTTCTCCGAATTCAATTTGGCGGCACTTGCCTCCAATCTCGATCGCAAGGTGCGCCAAATGATGCAACTCAACCTCCAAGCCGGACCCATCACCGCCGCCAGCAATTTCCTCTCCGAGGAGTCCCACAATGTCTCCCACAAGAGGAGTATGCCTTTGCCGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04141 map04141
Pfam Domains
Protein Families
Josephin

Protein Analysis

79

Amino Acids

8.82

Weight (kDa)

9.1

Isoelectric Point (pI)

59.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Josephin PF02099 9 - 71 1.1e-08 Josephin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019996)

Species Orthologous Gene IDs
rosa_laevigata RLG00000004066
rosa_multiflora Rmu_sc0002343.1_g000052 Rmu_sc0002902.1_g000041 Rmu_sc0004298.1_g000002
rosa_roxburghii Rroxscaffold_4G00322200
rosa_samantha Rh2DG198000 Rh3DG346100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 19, 95, 168, 171, 233
AcsI RAATTY 1 cut(s) 83
AdeI CACNNNGTG 1 cut(s) 16
AfaI GTAC 1 cut(s) 8
AfiI CCNNNNNNNGG 2 cut(s) 190, 216
AgsI TTSAA 1 cut(s) 88
Alw26I GTCTC 1 cut(s) 211
ApoI RAATTY 1 cut(s) 83
AspLEI GCGC 1 cut(s) 129
AspS9I GGNCC 2 cut(s) 68, 158
AsuHPI GGTGA 1 cut(s) 157
AvaII GGWCC 2 cut(s) 68, 158
BccI CCATC 1 cut(s) 170
BceAI ACGGC 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 211
BisI GCNGC 3 cut(s) 96, 171, 233
BlsI GCNGC 3 cut(s) 97, 172, 234
Bme18I GGWCC 2 cut(s) 68, 158
BmgT120I GGNCC 2 cut(s) 68, 158
BmiI GGNNCC 2 cut(s) 69, 160
BmsI GCATC 2 cut(s) 52, 126
BsaJI CCNNGG 2 cut(s) 10, 189
BsaXI ACNNNNNCTCC 4 cut(s) 132, 162, 191, 221
Bsc4I CCNNNNNNNGG 2 cut(s) 190, 216
BseDI CCNNGG 2 cut(s) 10, 189
BseLI CCNNNNNNNGG 2 cut(s) 190, 216
BseRI GAGGAG 2 cut(s) 206, 232
Bsh1285I CGRYCG 1 cut(s) 118
BsiEI CGRYCG 1 cut(s) 118
BsiSI CCGG 1 cut(s) 156
BslFI GGGAC 1 cut(s) 181
BslI CCNNNNNNNGG 2 cut(s) 190, 216
BsmAI GTCTC 1 cut(s) 211
BsmFI GGGAC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 115
BspACI CCGC 5 cut(s) 19, 95, 168, 171, 233
BspLI GGNNCC 2 cut(s) 69, 160
BssECI CCNNGG 2 cut(s) 10, 189
BssMI GATC 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 175
BstDSI CCRYGG 1 cut(s) 10
BstENI CCTNNNNNAGG 1 cut(s) 188
BstHHI GCGC 1 cut(s) 129
BstKTI GATC 1 cut(s) 118
BstMAI GTCTC 1 cut(s) 211
BstMBI GATC 1 cut(s) 115
BstMCI CGRYCG 1 cut(s) 118
BstMWI GCNNNNNNNGC 3 cut(s) 101, 126, 232
BtgI CCRYGG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 175
CfoI GCGC 1 cut(s) 129
Cfr13I GGNCC 2 cut(s) 68, 158
Csp6I GTAC 1 cut(s) 7
CviAII CATG 1 cut(s) 55
CviJI RGCY 2 cut(s) 31, 155
CviKI_1 RGCY 2 cut(s) 31, 155
CviQI GTAC 1 cut(s) 7
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
DraIII CACNNNGTG 1 cut(s) 16
Eco47I GGWCC 2 cut(s) 68, 158
EcoNI CCTNNNNNAGG 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 68
EcoRI GAATTC 1 cut(s) 83
FaeI CATG 1 cut(s) 58
FaiI YATR 3 cut(s) 56, 224, 238
FaqI GGGAC 1 cut(s) 181
FatI CATG 1 cut(s) 54
FauI CCCGC 1 cut(s) 12
Fnu4HI GCNGC 3 cut(s) 96, 171, 233
Fsp4HI GCNGC 3 cut(s) 96, 171, 233
GlaI GCGC 1 cut(s) 128
GluI GCNGC 3 cut(s) 96, 171, 233
HapII CCGG 1 cut(s) 156
HhaI GCGC 1 cut(s) 129
Hin1II CATG 1 cut(s) 58
Hin6I GCGC 1 cut(s) 127
HinP1I GCGC 1 cut(s) 127
HincII GTYRAC 1 cut(s) 52
HindII GTYRAC 1 cut(s) 52
HinfI GANTC 2 cut(s) 23, 194
HpaII CCGG 1 cut(s) 156
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 82, 190
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 52
HpyCH4V TGCA 3 cut(s) 43, 64, 139
HpyF10VI GCNNNNNNNGC 3 cut(s) 101, 126, 232
Hsp92II CATG 1 cut(s) 58
HspAI GCGC 1 cut(s) 127
Kzo9I GATC 1 cut(s) 115
LpnPI CCDG 3 cut(s) 50, 169, 187
LweI GCATC 2 cut(s) 52, 126
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 1 cut(s) 67
MluCI AATT 3 cut(s) 83, 88, 178
MlyI GAGTC 2 cut(s) 32, 203
MnlI CCTC 5 cut(s) 115, 158, 184, 194, 210
MspI CCGG 1 cut(s) 156
MwoI GCNNNNNNNGC 3 cut(s) 101, 126, 232
NdeII GATC 1 cut(s) 115
NlaIII CATG 1 cut(s) 58
NlaIV GGNNCC 2 cut(s) 69, 160
PkrI GCNGC 3 cut(s) 97, 172, 234
Ple19I CGATCG 1 cut(s) 118
PleI GAGTC 2 cut(s) 31, 202
PpsI GAGTC 2 cut(s) 31, 202
PpuMI RGGWCCY 1 cut(s) 68
Psp5II RGGWCCY 1 cut(s) 68
PspN4I GGNNCC 2 cut(s) 69, 160
PspPI GGNCC 2 cut(s) 68, 158
PspPPI RGGWCCY 1 cut(s) 68
PvuI CGATCG 1 cut(s) 118
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
SatI GCNGC 3 cut(s) 96, 171, 233
Sau3AI GATC 1 cut(s) 115
Sau96I GGNCC 2 cut(s) 68, 158
SchI GAGTC 2 cut(s) 32, 203
SetI ASST 2 cut(s) 126, 150
SfaNI GCATC 2 cut(s) 52, 126
SinI GGWCC 2 cut(s) 68, 158
Sse9I AATT 3 cut(s) 83, 88, 178
SsiI CCGC 5 cut(s) 19, 95, 168, 171, 233
TaqI TCGA 2 cut(s) 26, 114
TasI AATT 3 cut(s) 83, 88, 178
TauI GCSGC 3 cut(s) 98, 173, 235
VpaK11BI GGWCC 2 cut(s) 68, 158
XagI CCTNNNNNAGG 1 cut(s) 188
XapI RAATTY 1 cut(s) 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.