Rroxscaffold_5G00342690

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0018126
Physical Location & Seq
Reverse (-)
11792199 .. 11793574
1376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00342690.1

Sequence Viewer

Length: 471 bp
ATGGGTAACAGCTTTAACCGATGGGAGGGTGAAGGAGTCATCGGTAGTGAAAGAAGAAATGCAAACCTTGAAGAGCTAAAGCACTTGCCTCGACTAATCGCTTTACAAATACATATCCCGGATGCTAACATCCTTCCAGCAGATTTGTTCACCACTAGTAAGTTAAGGAGATTCCAAATATGTATTGGTTCTGCGTGGAAATGGTATAATGTGGATGAAGCCCTCAATGCACTAAAGCTCCGACTCACGCTAGCAATGAATTGGACCAAGGTTAGGTATCCCAACTTAACATGGTTGGCGTTGAATGACCTCAATGGTTTAAAATTCTTGTTATCATCTTCAATGGCTAGAAGCCTTGCACAACTCAAACGTTTGCAGGTATCGGGATGTCAAACAATGGAAGAGATAGTATCATTAGATGAATCGATGAAGAAATTGCAGACAGCTTATTTTGCCATCTACAAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04626 map04626
Pfam Domains
Protein Families
LRR_8 NB-ARC

Protein Analysis

156

Amino Acids

17.91

Weight (kDa)

9.51

Isoelectric Point (pI)

45.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_RPS2 PF23247 92 - 145 3e-06 Plant disease resistance protein RPS2-like, leucine-rich repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 367
AclI AACGTT 1 cut(s) 370
AcsI RAATTY 1 cut(s) 323
AfiI CCNNNNNNNGG 2 cut(s) 25, 273
AgsI TTSAA 3 cut(s) 71, 304, 342
AhlI ACTAGT 1 cut(s) 155
AluBI AGCT 4 cut(s) 12, 76, 238, 446
AluI AGCT 4 cut(s) 12, 76, 238, 446
ApoI RAATTY 1 cut(s) 323
AspS9I GGNCC 1 cut(s) 264
AsuC2I CCSGG 1 cut(s) 119
AsuHPI GGTGA 2 cut(s) 41, 142
AsuNHI GCTAGC 1 cut(s) 250
AvaII GGWCC 1 cut(s) 264
BccI CCATC 2 cut(s) 15, 464
BcgI CGANNNNNNTGC 2 cut(s) 71, 105
BciVI GTATCC 1 cut(s) 288
BcnI CCSGG 1 cut(s) 119
BcuI ACTAGT 1 cut(s) 155
BfaI CTAG 4 cut(s) 156, 251, 348, 469
BfuAI ACCTGC 1 cut(s) 367
BfuI GTATCC 1 cut(s) 288
BglII AGATCT 1 cut(s) 465
Bme1390I CCNGG 1 cut(s) 119
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
BmrFI CCNGG 1 cut(s) 119
BmsI GCATC 1 cut(s) 112
BmtI GCTAGC 1 cut(s) 254
BpuMI CCSGG 1 cut(s) 119
Bsa29I ATCGAT 1 cut(s) 425
BsaJI CCNNGG 1 cut(s) 267
BsaXI ACNNNNNCTCC 2 cut(s) 222, 252
Bsc4I CCNNNNNNNGG 2 cut(s) 25, 273
Bse3DI GCAATG 1 cut(s) 261
BseCI ATCGAT 1 cut(s) 425
BseDI CCNNGG 1 cut(s) 267
BseGI GGATG 4 cut(s) 127, 129, 220, 392
BseLI CCNNNNNNNGG 2 cut(s) 25, 273
BseMI GCAATG 1 cut(s) 261
BshVI ATCGAT 1 cut(s) 425
BsiSI CCGG 1 cut(s) 119
BslI CCNNNNNNNGG 2 cut(s) 25, 273
Bsp143I GATC 1 cut(s) 465
BspDI ATCGAT 1 cut(s) 425
BspMI ACCTGC 1 cut(s) 367
BspOI GCTAGC 1 cut(s) 254
BspQI GCTCTTC 1 cut(s) 66
BsrDI GCAATG 1 cut(s) 261
BssECI CCNNGG 1 cut(s) 267
BssMI GATC 1 cut(s) 465
BssT1I CCWWGG 1 cut(s) 267
Bst6I CTCTTC 2 cut(s) 66, 396
BstC8I GCNNGC 1 cut(s) 252
BstF5I GGATG 4 cut(s) 127, 129, 220, 392
BstKTI GATC 1 cut(s) 468
BstMBI GATC 1 cut(s) 465
BstMWI GCNNNNNNNGC 2 cut(s) 227, 452
BstSCI CCNGG 1 cut(s) 117
BstX2I RGATCY 1 cut(s) 465
BstYI RGATCY 1 cut(s) 465
Bsu15I ATCGAT 1 cut(s) 425
BsuI GTATCC 1 cut(s) 288
BsuTUI ATCGAT 1 cut(s) 425
BtsCI GGATG 4 cut(s) 127, 129, 220, 392
BveI ACCTGC 1 cut(s) 367
Cac8I GCNNGC 1 cut(s) 252
Cfr13I GGNCC 1 cut(s) 264
ClaI ATCGAT 1 cut(s) 425
CviAII CATG 1 cut(s) 291
CviJI RGCY 7 cut(s) 12, 76, 221, 238, 347, 354, 446
CviKI_1 RGCY 7 cut(s) 12, 76, 221, 238, 347, 354, 446
DpnI GATC 1 cut(s) 467
DpnII GATC 1 cut(s) 465
DraI TTTAAA 1 cut(s) 321
Eam1104I CTCTTC 2 cut(s) 66, 396
EarI CTCTTC 2 cut(s) 66, 396
Eco130I CCWWGG 1 cut(s) 267
Eco47I GGWCC 1 cut(s) 264
EcoT14I CCWWGG 1 cut(s) 267
ErhI CCWWGG 1 cut(s) 267
FaeI CATG 1 cut(s) 294
FaiI YATR 4 cut(s) 114, 181, 207, 292
FatI CATG 1 cut(s) 290
FokI GGATG 4 cut(s) 116, 134, 227, 399
FspBI CTAG 4 cut(s) 156, 251, 348, 469
HapII CCGG 1 cut(s) 119
Hin1II CATG 1 cut(s) 294
HinfI GANTC 4 cut(s) 36, 171, 243, 422
HpaII CCGG 1 cut(s) 119
HphI GGTGA 2 cut(s) 41, 142
Hpy166II GTNNAC 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 242
Hpy188III TCNNGA 1 cut(s) 384
Hpy8I GTNNAC 1 cut(s) 150
HpyAV CCTTC 2 cut(s) 26, 143
HpyCH4IV ACGT 1 cut(s) 370
HpyCH4V TGCA 5 cut(s) 62, 230, 359, 376, 439
HpyF10VI GCNNNNNNNGC 2 cut(s) 227, 452
HpySE526I ACGT 1 cut(s) 370
Hsp92II CATG 1 cut(s) 294
Kzo9I GATC 1 cut(s) 465
LguI GCTCTTC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 243
LpnPI CCDG 3 cut(s) 132, 150, 362
LweI GCATC 1 cut(s) 112
MaeI CTAG 4 cut(s) 156, 251, 348, 469
MaeII ACGT 1 cut(s) 370
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 467
MboI GATC 1 cut(s) 465
MboII GAAGA 5 cut(s) 66, 83, 330, 413, 442
MflI RGATCY 1 cut(s) 465
MluCI AATT 3 cut(s) 259, 323, 434
MlyI GAGTC 2 cut(s) 45, 237
MmeI TCCRAC 1 cut(s) 265
MnlI CCTC 4 cut(s) 19, 99, 233, 320
MseI TTAA 4 cut(s) 15, 164, 287, 320
MspI CCGG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 119
MwoI GCNNNNNNNGC 2 cut(s) 227, 452
NciI CCSGG 1 cut(s) 119
NdeII GATC 1 cut(s) 465
NheI GCTAGC 1 cut(s) 250
NlaIII CATG 1 cut(s) 294
PciSI GCTCTTC 1 cut(s) 66
PfeI GAWTC 2 cut(s) 171, 422
PfoI TCCNGGA 1 cut(s) 117
PleI GAGTC 2 cut(s) 44, 237
PpsI GAGTC 2 cut(s) 44, 237
Psp1406I AACGTT 1 cut(s) 370
PspPI GGNCC 1 cut(s) 264
PsuI RGATCY 1 cut(s) 465
SapI GCTCTTC 1 cut(s) 66
SaqAI TTAA 4 cut(s) 15, 164, 287, 320
Sau3AI GATC 1 cut(s) 465
Sau96I GGNCC 1 cut(s) 264
SchI GAGTC 2 cut(s) 45, 237
ScrFI CCNGG 1 cut(s) 119
SfaNI GCATC 1 cut(s) 112
SinI GGWCC 1 cut(s) 264
SpeI ACTAGT 1 cut(s) 155
Sse9I AATT 3 cut(s) 259, 323, 434
SspMI CTAG 4 cut(s) 156, 251, 348, 469
StyD4I CCNGG 1 cut(s) 117
StyI CCWWGG 1 cut(s) 267
TaiI ACGT 1 cut(s) 373
TaqI TCGA 2 cut(s) 91, 425
TasI AATT 3 cut(s) 259, 323, 434
TfiI GAWTC 2 cut(s) 171, 422
Tru1I TTAA 4 cut(s) 15, 164, 287, 320
Tru9I TTAA 4 cut(s) 15, 164, 287, 320
TspDTI ATGAA 4 cut(s) 231, 272, 435, 443
VpaK11BI GGWCC 1 cut(s) 264
XapI RAATTY 1 cut(s) 323
XcmI CCANNNNNNNNNTGG 1 cut(s) 182
XspI CTAG 4 cut(s) 156, 251, 348, 469
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.