Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4B

Orthogroup ID

OG0018126

Physical Location & Seq

Genomic Coordinates Forward (+)

13267649 .. 13268164

Gene Structure 516 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4BG075100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

ATGGGAGAAGCATGGGATGCATTAAATTCATTGCTTGAGAAACTTAAGGATTCTTGTCTACTACTTGACCATGAAGATAGTGGGTTTGTCAAGATGCCTGATCTTGTGCATGATGTTGCTAAACGTATCTCATCGAGGGACCTACACATGTTGAAAGTAAGTGGTGGAGATGAGTTTAAAGAATGGCCAGATAATAAGAATTTCTGTGAAAAGTGCACTATGATCTCCCTTGAAATGTCCAATATCCCCAAGCTTCCTGAAGTTTTGCAATGCACAGAACTAAAGTTCATTGTTCTTAGCGCTACTGGTGAGGATTACTCCCTAGAAATTTCGTGCAACTTTTTTAAAGAAACGACAAAGCTCAATGTGTTGGATTTTACTGGTTTGAGTATCCCGTCGCTACCACCATCTCTTCAGTTCTTAAAAAGTCTGAAGACATTGTGTTTAGATGAGTGCACCTTGGGAGATATAGCTCTAATTGGCCAACTACAAAACTTAGAAATGCTTAGCTTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

LRR_8 NB-ARC

Protein Analysis

171

Amino Acids

19.21

Weight (kDa)

4.65

Isoelectric Point (pI)

45.36

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018126)

Species	Orthologous Gene IDs
prunus_persica	Prupe.3G130200_v2.0.a1
pyrus_communis	pycom15g06580
rosa_multiflora	Rmu_sc0002460.1_g000019
rosa_roxburghii	Rroxscaffold_2G00132360 Rroxscaffold_5G00341130 Rroxscaffold_5G00342690
rosa_samantha	Rh4BG075100 Rh5BG123900 Rh5CG057900 Rh5CG135200 Rh7CG472800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	58
AcoI	YGGCCR	2 cut(s)	185, 481
AcsI	RAATTY	3 cut(s)	25, 199, 327
AcuI	CTGAAG	3 cut(s)	279, 398, 452
AfeI	AGCGCT	1 cut(s)	301
AflII	CTTAAG	1 cut(s)	44
AflIII	ACRYGT	1 cut(s)	147
AgsI	TTSAA	2 cut(s)	154, 233
AluBI	AGCT	4 cut(s)	253, 361, 473, 510
AluI	AGCT	4 cut(s)	253, 361, 473, 510
Alw21I	GWGCWC	2 cut(s)	218, 458
Alw44I	GTGCAC	2 cut(s)	214, 454
Aor51HI	AGCGCT	1 cut(s)	301
AoxI	GGCC	2 cut(s)	185, 481
ApaLI	GTGCAC	2 cut(s)	214, 454
ApoI	RAATTY	3 cut(s)	25, 199, 327
AspLEI	GCGC	1 cut(s)	302
AspS9I	GGNCC	1 cut(s)	139
AsuHPI	GGTGA	1 cut(s)	320
AvaII	GGWCC	1 cut(s)	139
BaeGI	GKGCMC	2 cut(s)	218, 458
BalI	TGGCCA	2 cut(s)	187, 483
BbsI	GAAGAC	1 cut(s)	440
Bbv12I	GWGCWC	2 cut(s)	218, 458
BccI	CCATC	1 cut(s)	415
BciVI	GTATCC	1 cut(s)	401
BfaI	CTAG	1 cut(s)	323
BfoI	RGCGCY	1 cut(s)	303
BfrI	CTTAAG	1 cut(s)	44
BfuI	GTATCC	1 cut(s)	401
BlpI	GCTNAGC	1 cut(s)	506
Bme18I	GGWCC	1 cut(s)	139
BmgT120I	GGNCC	1 cut(s)	139
BmiI	GGNNCC	1 cut(s)	140
BmsI	GCATC	2 cut(s)	7, 84
BpiI	GAAGAC	1 cut(s)	440
BplI	GAGNNNNNCTC	2 cut(s)	302, 334
Bpu1102I	GCTNAGC	1 cut(s)	506
BpuEI	CTTGAG	1 cut(s)	56
BsaJI	CCNNGG	1 cut(s)	459
Bse1I	ACTGG	2 cut(s)	310, 385
Bse3DI	GCAATG	2 cut(s)	29, 275
BseDI	CCNNGG	1 cut(s)	459
BseGI	GGATG	1 cut(s)	22
BseMI	GCAATG	2 cut(s)	29, 275
BseNI	ACTGG	2 cut(s)	310, 385
BseSI	GKGCMC	2 cut(s)	218, 458
BshFI	GGCC	2 cut(s)	187, 483
BsiHKAI	GWGCWC	2 cut(s)	218, 458
BslFI	GGGAC	1 cut(s)	152
BsmFI	GGGAC	1 cut(s)	152
BsnI	GGCC	2 cut(s)	187, 483
Bsp1286I	GDGCHC	2 cut(s)	218, 458
Bsp143I	GATC	2 cut(s)	100, 222
Bsp1720I	GCTNAGC	1 cut(s)	506
BspANI	GGCC	2 cut(s)	187, 483
BspLI	GGNNCC	1 cut(s)	140
BspTI	CTTAAG	1 cut(s)	44
BsrDI	GCAATG	2 cut(s)	29, 275
BsrI	ACTGG	2 cut(s)	310, 385
BssECI	CCNNGG	1 cut(s)	459
BssMI	GATC	2 cut(s)	100, 222
BssT1I	CCWWGG	1 cut(s)	459
Bst6I	CTCTTC	1 cut(s)	417
BstAFI	CTTAAG	1 cut(s)	44
BstAPI	GCANNNNNTGC	1 cut(s)	17
BstDEI	CTNAG	3 cut(s)	296, 496, 506
BstF5I	GGATG	1 cut(s)	22
BstH2I	RGCGCY	1 cut(s)	303
BstHHI	GCGC	1 cut(s)	302
BstKTI	GATC	2 cut(s)	103, 225
BstMBI	GATC	2 cut(s)	100, 222
BstMWI	GCNNNNNNNGC	1 cut(s)	17
BstNSI	RCATGY	1 cut(s)	151
BstSLI	GKGCMC	2 cut(s)	218, 458
BstV2I	GAAGAC	1 cut(s)	440
BsuI	GTATCC	1 cut(s)	401
BsuRI	GGCC	2 cut(s)	187, 483
BtsCI	GGATG	1 cut(s)	22
CfoI	GCGC	1 cut(s)	302
Cfr13I	GGNCC	1 cut(s)	139
CviAII	CATG	4 cut(s)	12, 71, 110, 148
CviJI	RGCY	6 cut(s)	187, 253, 361, 473, 483, 510
CviKI_1	RGCY	6 cut(s)	187, 253, 361, 473, 483, 510
DdeI	CTNAG	3 cut(s)	296, 496, 506
DpnI	GATC	2 cut(s)	102, 224
DpnII	GATC	2 cut(s)	100, 222
DraI	TTTAAA	2 cut(s)	178, 346
EaeI	YGGCCR	2 cut(s)	185, 481
Eam1104I	CTCTTC	1 cut(s)	417
EarI	CTCTTC	1 cut(s)	417
Eco130I	CCWWGG	1 cut(s)	459
Eco47I	GGWCC	1 cut(s)	139
Eco47III	AGCGCT	1 cut(s)	301
Eco57I	CTGAAG	3 cut(s)	279, 398, 452
EcoO109I	RGGNCCY	1 cut(s)	139
EcoT14I	CCWWGG	1 cut(s)	459
EcoT22I	ATGCAT	1 cut(s)	22
ErhI	CCWWGG	1 cut(s)	459
FaeI	CATG	4 cut(s)	15, 74, 113, 151
FaiI	YATR	6 cut(s)	13, 72, 111, 149, 221, 470
FaqI	GGGAC	1 cut(s)	152
FatI	CATG	4 cut(s)	11, 70, 109, 147
FblI	GTMKAC	1 cut(s)	58
FokI	GGATG	1 cut(s)	29
FspBI	CTAG	1 cut(s)	323
GlaI	GCGC	1 cut(s)	301
HaeII	RGCGCY	1 cut(s)	303
HaeIII	GGCC	2 cut(s)	187, 483
HhaI	GCGC	1 cut(s)	302
Hin1II	CATG	4 cut(s)	15, 74, 113, 151
Hin6I	GCGC	1 cut(s)	300
HinP1I	GCGC	1 cut(s)	300
HindIII	AAGCTT	1 cut(s)	251
HinfI	GANTC	1 cut(s)	50
HphI	GGTGA	1 cut(s)	320
Hpy166II	GTNNAC	3 cut(s)	59, 216, 456
Hpy188I	TCNGA	1 cut(s)	432
Hpy188III	TCNNGA	2 cut(s)	91, 257
Hpy8I	GTNNAC	3 cut(s)	59, 216, 456
Hpy99I	CGWCG	1 cut(s)	400
HpyCH4IV	ACGT	1 cut(s)	124
HpyCH4V	TGCA	7 cut(s)	20, 109, 216, 268, 273, 336, 456
HpyF10VI	GCNNNNNNNGC	1 cut(s)	17
HpyF3I	CTNAG	3 cut(s)	296, 496, 506
HpySE526I	ACGT	1 cut(s)	124
Hsp92II	CATG	4 cut(s)	15, 74, 113, 151
HspAI	GCGC	1 cut(s)	300
Kzo9I	GATC	2 cut(s)	100, 222
LpnPI	CCDG	5 cut(s)	111, 201, 270, 291, 366
LweI	GCATC	2 cut(s)	7, 84
MaeI	CTAG	1 cut(s)	323
MaeII	ACGT	1 cut(s)	124
MalI	GATC	2 cut(s)	102, 224
MboI	GATC	2 cut(s)	100, 222
MboII	GAAGA	3 cut(s)	86, 404, 445
MhlI	GDGCHC	2 cut(s)	218, 458
MlsI	TGGCCA	2 cut(s)	187, 483
MluCI	AATT	4 cut(s)	25, 199, 327, 477
MluNI	TGGCCA	2 cut(s)	187, 483
MmeI	TCCRAC	1 cut(s)	351
MnlI	CCTC	2 cut(s)	129, 304
Mox20I	TGGCCA	2 cut(s)	187, 483
Mph1103I	ATGCAT	1 cut(s)	22
MscI	TGGCCA	2 cut(s)	187, 483
MseI	TTAA	5 cut(s)	23, 45, 177, 345, 422
Msp20I	TGGCCA	2 cut(s)	187, 483
MspCI	CTTAAG	1 cut(s)	44
MwoI	GCNNNNNNNGC	1 cut(s)	17
NdeII	GATC	2 cut(s)	100, 222
NlaIII	CATG	4 cut(s)	15, 74, 113, 151
NlaIV	GGNNCC	1 cut(s)	140
NsiI	ATGCAT	1 cut(s)	22
NspI	RCATGY	1 cut(s)	151
PciI	ACATGT	1 cut(s)	147
PfeI	GAWTC	1 cut(s)	50
PpuMI	RGGWCCY	1 cut(s)	139
PscI	ACATGT	1 cut(s)	147
Psp5II	RGGWCCY	1 cut(s)	139
PspN4I	GGNNCC	1 cut(s)	140
PspPI	GGNCC	1 cut(s)	139
PspPPI	RGGWCCY	1 cut(s)	139
SaqAI	TTAA	5 cut(s)	23, 45, 177, 345, 422
Sau3AI	GATC	2 cut(s)	100, 222
Sau96I	GGNCC	1 cut(s)	139
SduI	GDGCHC	2 cut(s)	218, 458
SetI	ASST	7 cut(s)	127, 144, 255, 363, 461, 475, 512
SfaNI	GCATC	2 cut(s)	7, 84
SinI	GGWCC	1 cut(s)	139
SmlI	CTYRAG	2 cut(s)	35, 44
SmoI	CTYRAG	2 cut(s)	35, 44
Sse9I	AATT	4 cut(s)	25, 199, 327, 477
SspMI	CTAG	1 cut(s)	323
StyI	CCWWGG	1 cut(s)	459
TaiI	ACGT	1 cut(s)	127
TaqI	TCGA	1 cut(s)	134
TasI	AATT	4 cut(s)	25, 199, 327, 477
TfiI	GAWTC	1 cut(s)	50
Tru1I	TTAA	5 cut(s)	23, 45, 177, 345, 422
Tru9I	TTAA	5 cut(s)	23, 45, 177, 345, 422
TspDTI	ATGAA	3 cut(s)	18, 87, 277
Vha464I	CTTAAG	1 cut(s)	44
VneI	GTGCAC	2 cut(s)	214, 454
VpaK11BI	GGWCC	1 cut(s)	139
XapI	RAATTY	3 cut(s)	25, 199, 327
XceI	RCATGY	1 cut(s)	151
XcmI	CCANNNNNNNNNTGG	1 cut(s)	77
XmiI	GTMKAC	1 cut(s)	58
XspI	CTAG	1 cut(s)	323
Zsp2I	ATGCAT	1 cut(s)	22

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.