Rroxscaffold_5G00359190

DYW family of nucleic acid deaminases

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
39277030 .. 39279455
2426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00359190.1

Sequence Viewer

Length: 246 bp
ATGCTTGCACGCCAAGTGTTTGATGAAATTACCCAACCAGATTTGCCATCTTGGAATTCGATCATAGATGCGTATGTGAAAGTGGGTCTGATTGATGTTGCTCGAGAGATGTTCGATGAAATGCCCAAGAGAAATATGATCTCTTGGAGTTGTATGATAAAAGGTATGTCAATAGATAGCAGTGGAAAGATATGCAATGACAATTATAACTTGAGTATTATAATGAAAATTTATGCGATGATTTGA

Protein Analysis

81

Amino Acids

9.31

Weight (kDa)

4.81

Isoelectric Point (pI)

47.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 12 - 41 3.8e-06 PPR repeat
PPR_2 PF13041 13 - 56 1.1e-08 PPR repeat family
PPR PF01535 17 - 45 1.9e-08 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020533)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 207, 221
AcsI RAATTY 2 cut(s) 55, 228
Ama87I CYCGRG 1 cut(s) 102
ApoI RAATTY 2 cut(s) 55, 228
AvaI CYCGRG 1 cut(s) 102
BccI CCATC 1 cut(s) 55
BmeT110I CYCGRG 1 cut(s) 102
BmsI GCATC 1 cut(s) 58
BpuEI CTTGAG 1 cut(s) 232
Bse3DI GCAATG 1 cut(s) 202
BseMI GCAATG 1 cut(s) 202
BsiHKCI CYCGRG 1 cut(s) 102
BsoBI CYCGRG 1 cut(s) 102
Bsp143I GATC 2 cut(s) 60, 138
BsrDI GCAATG 1 cut(s) 202
BssMI GATC 2 cut(s) 60, 138
BstC8I GCNNGC 2 cut(s) 6, 10
BstKTI GATC 2 cut(s) 63, 141
BstMBI GATC 2 cut(s) 60, 138
BtsI GCAGTG 1 cut(s) 187
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 2 cut(s) 6, 10
DpnI GATC 2 cut(s) 62, 140
DpnII GATC 2 cut(s) 60, 138
Eco88I CYCGRG 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 55
FaiI YATR 9 cut(s) 65, 75, 137, 155, 167, 193, 207, 221, 234
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 8, 195
Kzo9I GATC 2 cut(s) 60, 138
LpnPI CCDG 1 cut(s) 51
LweI GCATC 1 cut(s) 58
MalI GATC 2 cut(s) 62, 140
MboI GATC 2 cut(s) 60, 138
MluCI AATT 4 cut(s) 27, 55, 202, 228
NdeII GATC 2 cut(s) 60, 138
PaeR7I CTCGAG 1 cut(s) 102
PsiI TTATAA 2 cut(s) 207, 221
Sau3AI GATC 2 cut(s) 60, 138
SetI ASST 1 cut(s) 166
SfaNI GCATC 1 cut(s) 58
Sfr274I CTCGAG 1 cut(s) 102
SlaI CTCGAG 1 cut(s) 102
SmlI CTYRAG 2 cut(s) 102, 211
SmoI CTYRAG 2 cut(s) 102, 211
Sse9I AATT 4 cut(s) 27, 55, 202, 228
TaqI TCGA 3 cut(s) 59, 103, 114
TasI AATT 4 cut(s) 27, 55, 202, 228
TscAI CASTG 1 cut(s) 187
TspDTI ATGAA 3 cut(s) 39, 132, 239
TspRI CASTG 1 cut(s) 187
XapI RAATTY 2 cut(s) 55, 228
XhoI CTCGAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.