Rorug05G0188300

DYW family of nucleic acid deaminases

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
18284165 .. 18285019
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0188300.1

Sequence Viewer

Length: 408 bp
ATGAAGAAGATCAGTTTGCTATTAAGGAAGTGCAAGAGCTTGTCAAGCCAGCTAGGGAGATCTTCATCGTATAGCAGTCTACGTTCCACATCGACTAGAGAAGATTTGTATGATGGCAACATCATGAATGAGAATCATCAGCAAACTACTATATTTGTTGGAAGCACCAGAAAGCGTTACGTGATCAGCTCCAAGTACCTGAAGCATCCTTTGTTGAATGCTTTGATCGAGAAGTCATCGAATAAGCGAAATAACAATCGAGGAGATGATCATGATCATGAGGATATCTTGGTGAAGTGTGAGGTGGTTCTCTTTGATCACTTGTTATGGATGCTGGAAAATGGAGATCCAAGCTTTGGTGGTACTTCAGAGTCTTTGGAGGAACTAGCTGAACTCTATGAGTTCTAA

Protein Analysis

135

Amino Acids

15.5

Weight (kDa)

6.51

Isoelectric Point (pI)

56.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 43 - 112 7.2e-14 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020533)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 356
AccI GTMKAC 1 cut(s) 79
AclWI GGATC 1 cut(s) 341
AcuI CTGAAG 2 cut(s) 221, 351
AfaI GTAC 2 cut(s) 197, 364
AfiI CCNNNNNNNGG 1 cut(s) 356
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 5 cut(s) 39, 52, 189, 354, 389
AluI AGCT 5 cut(s) 39, 52, 189, 354, 389
AlwI GGATC 1 cut(s) 341
AsuHPI GGTGA 1 cut(s) 304
BccI CCATC 1 cut(s) 107
BclI TGATCA 4 cut(s) 183, 268, 274, 316
BfaI CTAG 3 cut(s) 53, 96, 386
BglII AGATCT 1 cut(s) 59
BmsI GCATC 2 cut(s) 214, 321
BsaAI YACGTR 1 cut(s) 181
BsaBI GATNNNNATC 2 cut(s) 64, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 356
Bse8I GATNNNNATC 2 cut(s) 64, 273
BseGI GGATG 2 cut(s) 205, 336
BseJI GATNNNNATC 2 cut(s) 64, 273
BseLI CCNNNNNNNGG 1 cut(s) 356
BseRI GAGGAG 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 356
BsmI GAATGC 1 cut(s) 223
Bsp143I GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
BspHI TCATGA 3 cut(s) 123, 271, 277
BspPI GGATC 1 cut(s) 341
BssMI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
BstBAI YACGTR 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 50
BstF5I GGATG 2 cut(s) 205, 336
BstKTI GATC 8 cut(s) 12, 62, 186, 228, 271, 277, 319, 349
BstMBI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstX2I RGATCY 2 cut(s) 59, 346
BstYI RGATCY 2 cut(s) 59, 346
BtsCI GGATG 2 cut(s) 205, 336
Cac8I GCNNGC 1 cut(s) 50
CciI TCATGA 3 cut(s) 123, 271, 277
Csp6I GTAC 2 cut(s) 196, 363
CviAII CATG 3 cut(s) 124, 272, 278
CviJI RGCY 6 cut(s) 39, 48, 52, 189, 354, 389
CviKI_1 RGCY 6 cut(s) 39, 48, 52, 189, 354, 389
CviQI GTAC 2 cut(s) 196, 363
DpnI GATC 8 cut(s) 11, 61, 185, 227, 270, 276, 318, 348
DpnII GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
Eco32I GATATC 1 cut(s) 286
Eco57I CTGAAG 2 cut(s) 221, 351
EcoRV GATATC 1 cut(s) 286
FaeI CATG 3 cut(s) 127, 275, 281
FaiI YATR 8 cut(s) 72, 111, 125, 152, 273, 279, 328, 399
FatI CATG 3 cut(s) 123, 271, 277
FbaI TGATCA 4 cut(s) 183, 268, 274, 316
FblI GTMKAC 1 cut(s) 79
FokI GGATG 2 cut(s) 192, 343
FspBI CTAG 3 cut(s) 53, 96, 386
Hin1II CATG 3 cut(s) 127, 275, 281
HindIII AAGCTT 1 cut(s) 352
HinfI GANTC 2 cut(s) 133, 371
HphI GGTGA 1 cut(s) 304
Hpy166II GTNNAC 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 370
Hpy188III TCNNGA 4 cut(s) 124, 229, 272, 278
Hpy8I GTNNAC 1 cut(s) 80
HpyCH4IV ACGT 2 cut(s) 82, 180
HpyCH4V TGCA 1 cut(s) 33
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
HpySE526I ACGT 2 cut(s) 82, 180
Hsp92II CATG 3 cut(s) 127, 275, 281
Ksp22I TGATCA 4 cut(s) 183, 268, 274, 316
Kzo9I GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
LmnI GCTCC 1 cut(s) 194
LpnPI CCDG 4 cut(s) 62, 181, 212, 320
LweI GCATC 2 cut(s) 214, 321
MaeI CTAG 3 cut(s) 53, 96, 386
MaeII ACGT 2 cut(s) 82, 180
MaeIII GTNAC 1 cut(s) 176
MalI GATC 8 cut(s) 11, 61, 185, 227, 270, 276, 318, 348
MboI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
MboII GAAGA 4 cut(s) 16, 19, 54, 113
MflI RGATCY 2 cut(s) 59, 346
MlyI GAGTC 1 cut(s) 380
MmeI TCCRAC 1 cut(s) 139
MnlI CCTC 4 cut(s) 254, 274, 295, 373
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 276
Mva1269I GAATGC 1 cut(s) 223
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeII GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
NlaIII CATG 3 cut(s) 127, 275, 281
PagI TCATGA 3 cut(s) 123, 271, 277
PctI GAATGC 1 cut(s) 223
PfeI GAWTC 1 cut(s) 133
PflMI CCANNNNNTGG 1 cut(s) 356
PleI GAGTC 1 cut(s) 379
PpsI GAGTC 1 cut(s) 379
Ppu21I YACGTR 1 cut(s) 181
PsuI RGATCY 2 cut(s) 59, 346
RsaI GTAC 2 cut(s) 197, 364
RsaNI GTAC 2 cut(s) 196, 363
RseI CAYNNNNRTG 1 cut(s) 276
SaqAI TTAA 1 cut(s) 23
Sau3AI GATC 8 cut(s) 9, 59, 183, 225, 268, 274, 316, 346
SchI GAGTC 1 cut(s) 380
SetI ASST 9 cut(s) 41, 54, 85, 183, 191, 201, 306, 356, 391
SfaNI GCATC 2 cut(s) 214, 321
SmiMI CAYNNNNRTG 1 cut(s) 276
SspMI CTAG 3 cut(s) 53, 96, 386
TaiI ACGT 2 cut(s) 85, 183
TaqI TCGA 4 cut(s) 92, 228, 239, 259
TfiI GAWTC 1 cut(s) 133
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TspDTI ATGAA 3 cut(s) 17, 54, 140
Van91I CCANNNNNTGG 1 cut(s) 356
XmiI GTMKAC 1 cut(s) 79
XspI CTAG 3 cut(s) 53, 96, 386
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.