Rroxscaffold_5G00373580

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
OG0018712
Physical Location & Seq
Forward (+)
54783307 .. 54784324
1018 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00373580.1

Sequence Viewer

Length: 231 bp
ATGGCTTCGCATCAGAGTGGAAGGGCTTTACCCAAATTTGGCGAGTGGGATGTGAATGATCCAGCCTCAGCTGAAGGATTTACCATCATTTTCAACAAGGCCAGAGCTGACAAGAAAAATGGTGGAAGTTTACTTACTGCTGCGGAATCATCAAGCAACTATGAATCCCGTAAAGAAAATAATACGCAAAAGTATCCCAAAAGGAACAAGTGGCTTTGCATGGGTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

76

Amino Acids

8.44

Weight (kDa)

9.3

Isoelectric Point (pI)

46.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 7 - 39 1.3e-18 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018712)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g24970
malus_domestica MD13G1107600.v1.1
prunus_persica Prupe.1G238800_v2.0.a1
pyrus_communis pycom16g09170
rosa_multiflora Rmu_sc0004965.1_g000022
rosa_roxburghii Rroxscaffold_5G00373580
rosa_rugosa Rorug04G0254300
rosa_samantha Rh4CG334300
rosa_wichuraiana Rw4G027090

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 143
AclWI GGATC 1 cut(s) 53
AcsI RAATTY 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 2 cut(s) 71, 107
AluI AGCT 2 cut(s) 71, 107
AlwI GGATC 1 cut(s) 53
AoxI GGCC 1 cut(s) 99
ApeKI GCWGC 1 cut(s) 140
ApoI RAATTY 1 cut(s) 35
BarI GAAGNNNNNNTAC 2 cut(s) 118, 150
BbvCI CCTCAGC 1 cut(s) 67
BbvI GCAGC 1 cut(s) 127
BccI CCATC 1 cut(s) 92
BciVI GTATCC 1 cut(s) 204
BfuI GTATCC 1 cut(s) 204
BisI GCNGC 1 cut(s) 141
BlsI GCNGC 1 cut(s) 142
BmsI GCATC 1 cut(s) 19
Bpu10I CCTNAGC 1 cut(s) 67
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMII CTCAG 1 cut(s) 81
BseXI GCAGC 1 cut(s) 127
BshFI GGCC 1 cut(s) 101
BslI CCNNNNNNNGG 1 cut(s) 38
BsnI GGCC 1 cut(s) 101
Bsp143I GATC 1 cut(s) 58
BspACI CCGC 1 cut(s) 143
BspANI GGCC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 80
BspPI GGATC 1 cut(s) 53
BssMI GATC 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 67
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstV1I GCAGC 1 cut(s) 127
BsuI GTATCC 1 cut(s) 204
BsuRI GGCC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 55
CviAII CATG 1 cut(s) 220
CviJI RGCY 7 cut(s) 5, 26, 65, 71, 101, 107, 214
CviKI_1 RGCY 7 cut(s) 5, 26, 65, 71, 101, 107, 214
DdeI CTNAG 1 cut(s) 67
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eco57I CTGAAG 1 cut(s) 93
FaeI CATG 1 cut(s) 223
FaiI YATR 2 cut(s) 162, 221
FatI CATG 1 cut(s) 219
Fnu4HI GCNGC 1 cut(s) 141
FokI GGATG 1 cut(s) 62
Fsp4HI GCNGC 1 cut(s) 141
GluI GCNGC 1 cut(s) 141
HaeIII GGCC 1 cut(s) 101
Hin1II CATG 1 cut(s) 223
HinfI GANTC 2 cut(s) 146, 164
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 15
Hpy8I GTNNAC 1 cut(s) 131
HpyAV CCTTC 2 cut(s) 15, 68
HpyCH4V TGCA 1 cut(s) 219
HpyF3I CTNAG 1 cut(s) 67
Hsp92II CATG 1 cut(s) 223
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 75, 115
Lsp1109I GCAGC 1 cut(s) 127
LweI GCATC 1 cut(s) 19
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MluCI AATT 1 cut(s) 35
MnlI CCTC 1 cut(s) 76
MseI TTAA 1 cut(s) 229
MslI CAYNNNNRTG 1 cut(s) 15
MspA1I CMGCKG 1 cut(s) 71
NdeII GATC 1 cut(s) 58
NlaIII CATG 1 cut(s) 223
PfeI GAWTC 2 cut(s) 146, 164
PkrI GCNGC 1 cut(s) 142
PvuII CAGCTG 1 cut(s) 71
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 1 cut(s) 229
SatI GCNGC 1 cut(s) 141
Sau3AI GATC 1 cut(s) 58
SetI ASST 2 cut(s) 73, 109
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 8 cut(s) 55, 74, 109, 114, 124, 165, 180, 220
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 1 cut(s) 35
SsiI CCGC 1 cut(s) 143
TasI AATT 1 cut(s) 35
TfiI GAWTC 2 cut(s) 146, 164
Tru1I TTAA 1 cut(s) 229
Tru9I TTAA 1 cut(s) 229
TseI GCWGC 1 cut(s) 140
TspDTI ATGAA 1 cut(s) 177
XapI RAATTY 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.