Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4C

Orthogroup ID

OG0018712

Physical Location & Seq

Genomic Coordinates Forward (+)

59487125 .. 59487879

Gene Structure 755 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4CG334300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 231 bp

ATGGCTTCGCATCAGAGTGGAAGGGCTTTACCCAAATTTGGCGAGTGGGATGTGAATGATCCAGCCTCAGCTGAAGGATTTACCATCATTTTCAACAAGGCCAGAGCTGACAAGAAAAATGGTGGAAGTTTACTTACTGCTGTGGAATCATCAAGCAACTGTGAATCCCGTAAAGAAAATAATACGCAGAAGTATCCCAAAAGGAACAAGTGGCTTTGCATGGGTTGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AvrRpt-cleavage

Protein Analysis

76

Amino Acids

8.41

Weight (kDa)

9.18

Isoelectric Point (pI)

46.65

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
AvrRpt-cleavage	PF05627	7 - 39	1.3e-18	Cleavage site for pathogenic type III effector avirulence factor Avr

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018712)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g24970
malus_domestica	MD13G1107600.v1.1
prunus_persica	Prupe.1G238800_v2.0.a1
pyrus_communis	pycom16g09170
rosa_multiflora	Rmu_sc0004965.1_g000022
rosa_roxburghii	Rroxscaffold_5G00373580
rosa_rugosa	Rorug04G0254300
rosa_samantha	Rh4CG334300
rosa_wichuraiana	Rw4G027090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	53
AcsI	RAATTY	1 cut(s)	35
AcuI	CTGAAG	1 cut(s)	93
AfiI	CCNNNNNNNGG	1 cut(s)	38
AgsI	TTSAA	1 cut(s)	94
AluBI	AGCT	2 cut(s)	71, 107
AluI	AGCT	2 cut(s)	71, 107
AlwI	GGATC	1 cut(s)	53
AoxI	GGCC	1 cut(s)	99
ApoI	RAATTY	1 cut(s)	35
BarI	GAAGNNNNNNTAC	2 cut(s)	118, 150
BbvCI	CCTCAGC	1 cut(s)	67
BccI	CCATC	1 cut(s)	92
BciVI	GTATCC	1 cut(s)	204
BfuI	GTATCC	1 cut(s)	204
BmsI	GCATC	1 cut(s)	19
Bpu10I	CCTNAGC	1 cut(s)	67
Bsc4I	CCNNNNNNNGG	1 cut(s)	38
BseGI	GGATG	1 cut(s)	55
BseLI	CCNNNNNNNGG	1 cut(s)	38
BseMII	CTCAG	1 cut(s)	81
BshFI	GGCC	1 cut(s)	101
BslI	CCNNNNNNNGG	1 cut(s)	38
BsnI	GGCC	1 cut(s)	101
Bsp143I	GATC	1 cut(s)	58
BspANI	GGCC	1 cut(s)	101
BspCNI	CTCAG	1 cut(s)	80
BspPI	GGATC	1 cut(s)	53
BssMI	GATC	1 cut(s)	58
Bst4CI	ACNGT	1 cut(s)	161
BstDEI	CTNAG	1 cut(s)	67
BstF5I	GGATG	1 cut(s)	55
BstKTI	GATC	1 cut(s)	61
BstMBI	GATC	1 cut(s)	58
BsuI	GTATCC	1 cut(s)	204
BsuRI	GGCC	1 cut(s)	101
BtsCI	GGATG	1 cut(s)	55
CviAII	CATG	1 cut(s)	220
CviJI	RGCY	7 cut(s)	5, 26, 65, 71, 101, 107, 214
CviKI_1	RGCY	7 cut(s)	5, 26, 65, 71, 101, 107, 214
DdeI	CTNAG	1 cut(s)	67
DpnI	GATC	1 cut(s)	60
DpnII	GATC	1 cut(s)	58
Eco57I	CTGAAG	1 cut(s)	93
FaeI	CATG	1 cut(s)	223
FaiI	YATR	1 cut(s)	221
FatI	CATG	1 cut(s)	219
FokI	GGATG	1 cut(s)	62
HaeIII	GGCC	1 cut(s)	101
Hin1II	CATG	1 cut(s)	223
HinfI	GANTC	2 cut(s)	146, 164
Hpy166II	GTNNAC	1 cut(s)	131
Hpy188I	TCNGA	1 cut(s)	15
Hpy8I	GTNNAC	1 cut(s)	131
HpyAV	CCTTC	2 cut(s)	15, 68
HpyCH4III	ACNGT	1 cut(s)	161
HpyCH4V	TGCA	1 cut(s)	219
HpyF3I	CTNAG	1 cut(s)	67
Hsp92II	CATG	1 cut(s)	223
Kzo9I	GATC	1 cut(s)	58
LpnPI	CCDG	2 cut(s)	75, 115
LweI	GCATC	1 cut(s)	19
MalI	GATC	1 cut(s)	60
MboI	GATC	1 cut(s)	58
MluCI	AATT	1 cut(s)	35
MnlI	CCTC	1 cut(s)	76
MseI	TTAA	1 cut(s)	229
MslI	CAYNNNNRTG	1 cut(s)	15
MspA1I	CMGCKG	1 cut(s)	71
NdeII	GATC	1 cut(s)	58
NlaIII	CATG	1 cut(s)	223
PfeI	GAWTC	2 cut(s)	146, 164
PvuII	CAGCTG	1 cut(s)	71
RseI	CAYNNNNRTG	1 cut(s)	15
SaqAI	TTAA	1 cut(s)	229
Sau3AI	GATC	1 cut(s)	58
SetI	ASST	2 cut(s)	73, 109
SfaNI	GCATC	1 cut(s)	19
SgeI	CNNG	8 cut(s)	55, 74, 109, 114, 124, 165, 180, 220
SmiMI	CAYNNNNRTG	1 cut(s)	15
Sse9I	AATT	1 cut(s)	35
TaaI	ACNGT	1 cut(s)	161
TasI	AATT	1 cut(s)	35
TfiI	GAWTC	2 cut(s)	146, 164
Tru1I	TTAA	1 cut(s)	229
Tru9I	TTAA	1 cut(s)	229
XapI	RAATTY	1 cut(s)	35

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.